Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • nirav99
    started a topic Error found while mapping Illumina data using BWA

    Error found while mapping Illumina data using BWA

    While mapping Illumina data against BWA, I noticed several errors :

    ERROR: Record 58, Read name HWI-ST142_0217:1:63:8795:27966#0, Mate negative strand flag does not match read negative strand flag of mate

    The corresponding reads are

    HWI-ST142_0217:1:63:8795:27966#0 89 chr1 27 0 52M1D48M = 27 0 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGAACCCAACCCTAACCCTAACCCTAACCCTAACCCTACCCTAACCCTAACCCTA BBBBBBB___T^^ddc^bccddYdaa``]^O_U]\bGbbbZ_PZ\ZPT\Zbdaadeeee`ddddd`caccb\bbbbb\bbdcTdddcadddd`dadcdcdXT:A:R NM:i:3 SM:i:0 AM:i:0 X0:i:3 X1:i:1 XM:i:2 XO:i:1 XG:i:1 MD:Z:46T5^T29A18 XA:Z:chr15,+100338770,17M1D83M,3;chr4,-62,82M1D18M,3;chr1,-21,52M1D48M,4;

    HWI-ST142_0217:1:63:8795:27966#0 181 chr1 27 0 * = 27 0 GGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTGGTTAGGG bT\^`^bddad\bdadbbdd``Yc`b\d`dbdd^d`ccc\`bYb`TUXYPeT\eecfdfdeeccfcefcfe\eeccfefeffeffffffffffcfcfeff

    The flag of these reads show up as

    1 0 1 1 0 0 1 - first read (forward strand of mate, reverse strand of query)
    1 0 1 1 0 1 0 1 - second read (reverse strand of mate, reverse strand of query)

    The sixth bit (from the left) for both these reads (mate strand) conflicts with the fifth bit (strand of the query).

    Is this the reason for the error I am seeing ? Is there a way to prevent such errors from occurring ?
    Last edited by nirav99; 09-02-2010, 01:47 PM. Reason: Adding new line for clarity of reading

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
54 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
42 views
0 likes
Last Post seqadmin  
Working...
X