While mapping Illumina data against BWA, I noticed several errors :
ERROR: Record 58, Read name HWI-ST142_0217:1:63:8795:27966#0, Mate negative strand flag does not match read negative strand flag of mate
The corresponding reads are
HWI-ST142_0217:1:63:8795:27966#0 89 chr1 27 0 52M1D48M = 27 0 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGAACCCAACCCTAACCCTAACCCTAACCCTAACCCTACCCTAACCCTAACCCTA BBBBBBB___T^^ddc^bccddYdaa``]^O_U]\bGbbbZ_PZ\ZPT\Zbdaadeeee`ddddd`caccb\bbbbb\bbdcTdddcadddd`dadcdcdXT:A:R NM:i:3 SM:i:0 AM:i:0 X0:i:3 X1:i:1 XM:i:2 XO:i:1 XG:i:1 MD:Z:46T5^T29A18 XA:Z:chr15,+100338770,17M1D83M,3;chr4,-62,82M1D18M,3;chr1,-21,52M1D48M,4;
HWI-ST142_0217:1:63:8795:27966#0 181 chr1 27 0 * = 27 0 GGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTGGTTAGGG bT\^`^bddad\bdadbbdd``Yc`b\d`dbdd^d`ccc\`bYb`TUXYPeT\eecfdfdeeccfcefcfe\eeccfefeffeffffffffffcfcfeff
The flag of these reads show up as
1 0 1 1 0 0 1 - first read (forward strand of mate, reverse strand of query)
1 0 1 1 0 1 0 1 - second read (reverse strand of mate, reverse strand of query)
The sixth bit (from the left) for both these reads (mate strand) conflicts with the fifth bit (strand of the query).
Is this the reason for the error I am seeing ? Is there a way to prevent such errors from occurring ?
-
The field of immunogenetics explores how genetic variations influence immune responses and susceptibility to disease. In a recent SEQanswers webinar, Oscar Rodriguez, Ph.D., Postdoctoral Researcher at the University of Louisville, and Ruben Martínez Barricarte, Ph.D., Assistant Professor of Medicine at Vanderbilt University, shared recent advancements in immunogenetics. This article discusses their research on genetic variation in antibody loci, antibody production processes,...11-06-2024, 07:24 PM -
Next-generation sequencing (NGS) and quantitative polymerase chain reaction (qPCR) are essential techniques for investigating the genome, transcriptome, and epigenome. In many cases, choosing the appropriate technique is straightforward, but in others, it can be more challenging to determine the most effective option. A simple distinction is that smaller, more focused projects are typically better suited for qPCR, while larger, more complex datasets benefit from NGS. However,...10-18-2024, 07:11 AM