Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • TBAENVS
    Junior Member
    • Jan 2016
    • 5

    Error with quality score?

    Hi all!

    I keep getting an error using the fastx_reverse_complement tool saying that I have an invalid quality score in one of my sequences in fastq format. The Error is:

    fastx_reverse_complement: Error: invalid quality score data on line 281780 (quality_tok = "@M02529:176:000000000-AKLWJ:1:2113:11418:25147 1:N:0:3"

    So I look up the line in the input file and it looks like this:

    Code:
    @M02529:176:000000000-AKLWJ:1:2113:11418:25147 1:N:0:3
    GATCTCCGGACTACTGGGGTTTCTAATCCTGTTTGCTCCCCTTGCTCTCGCGCCTCAGCGTCAGGTGTTAACTAGAAAACCGCTTTCGCCACAGGTGTTCTTCCACATATCTACGCATTTCACCGCTACACGTGGAATTCCGTTTTCTCCGTCAATCCTCTAGAATTGTAGTTTCAAATGCAGCTCCGAAGTTGAGCTTCGGAATTTCACATCTGACTTACAGTTCCGCCTACGCGCCCTTTACGCCCAATAATTCCGATTAATGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACACATCT
    +
    8@BCC<@6+,@FFGGGCFGEGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGIIIIIIIIIIIIIIIIGIIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIFGIIGIIIIIIIIIIIIIGIIIIIIIIIIIIIIIIGGGGECGGGFGGGGGGGGGGGGGF7EGGGGGGGGGGGGGGGGFFFGGGGGCCCCC
    I simply can not find where the error should be in the last quality line (phred 33 quality score).

    The input command is:

    fastx_reverse_complement -Q33 -i input_file.fastq -o output_file.fastq

    Can some of you just by looking at the quality score listed above see if something is wrong? Or is there something else in the sequence which is wrong?

    Thank you very much in advance!
    Last edited by GenoMax; 06-16-2016, 03:43 AM.
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    I wonder if it has a maximum line length. For some reason it thinks that the read name is part of the quality score, which is obviously not the case. There at least doesn't appear to be anything at all wrong with that fastq record.

    Comment

    • TBAENVS
      Junior Member
      • Jan 2016
      • 5

      #3
      Originally posted by dpryan View Post
      I wonder if it has a maximum line length. For some reason it thinks that the read name is part of the quality score, which is obviously not the case. There at least doesn't appear to be anything at all wrong with that fastq record.
      Thank for the reply dpryan!

      There is nothing about maximum line length in the fastc_reverse_complement manual. I will try to contact the developers of the fastx tool kit.

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        I suggest that you use reformat.sh from BBMap suite like so. It worked with your example above fine.

        Code:
        $ reformat.sh in=your.fq out=revcomp.fq rcomp=t
        There are many other options that you can look at by just reformat.sh on command line.

        Comment

        • westerman
          Rick Westerman
          • Jun 2008
          • 1104

          #5
          Also look at the line above the line in question. It may be causing a problem that continues to the troublesome line.

          Like GenoMax I recommend reformat.sh

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          20 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-23-2026, 11:41 AM
          0 responses
          19 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-20-2026, 11:10 AM
          0 responses
          26 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-13-2026, 10:26 AM
          0 responses
          38 views
          0 reactions
          Last Post SEQadmin2  
          Working...