Error with quality score?

[TBAENVS]

Hi all!

I keep getting an error using the fastx_reverse_complement tool saying that I have an invalid quality score in one of my sequences in fastq format. The Error is:

fastx_reverse_complement: Error: invalid quality score data on line 281780 (quality_tok = "@M02529:176:000000000-AKLWJ:1:2113:11418:25147 1:N:0:3"

So I look up the line in the input file and it looks like this:

@M02529:176:000000000-AKLWJ:1:2113:11418:25147 1:N:0:3
GATCTCCGGACTACTGGGGTTTCTAATCCTGTTTGCTCCCCTTGCTCTCGCGCCTCAGCGTCAGGTGTTAACTAGAAAACCGCTTTCGCCACAGGTGTTCTTCCACATATCTACGCATTTCACCGCTACACGTGGAATTCCGTTTTCTCCGTCAATCCTCTAGAATTGTAGTTTCAAATGCAGCTCCGAAGTTGAGCTTCGGAATTTCACATCTGACTTACAGTTCCGCCTACGCGCCCTTTACGCCCAATAATTCCGATTAATGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACACATCT
+
8@BCC<@6+,@FFGGGCFGEGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGGGGGIIIIIIIIIIIIIIIIGIIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIFGIIGIIIIIIIIIIIIIGIIIIIIIIIIIIIIIIGGGGECGGGFGGGGGGGGGGGGGF7EGGGGGGGGGGGGGGGGFFFGGGGGCCCCC

I simply can not find where the error should be in the last quality line (phred 33 quality score).

The input command is:

fastx_reverse_complement -Q33 -i input_file.fastq -o output_file.fastq

Can some of you just by looking at the quality score listed above see if something is wrong? Or is there something else in the sequence which is wrong?

Thank you very much in advance!

[dpryan]

I wonder if it has a maximum line length. For some reason it thinks that the read name is part of the quality score, which is obviously not the case. There at least doesn't appear to be anything at all wrong with that fastq record.

[TBAENVS]

I wonder if it has a maximum line length. For some reason it thinks that the read name is part of the quality score, which is obviously not the case. There at least doesn't appear to be anything at all wrong with that fastq record.

Thank for the reply dpryan!

There is nothing about maximum line length in the fastc_reverse_complement manual. I will try to contact the developers of the fastx tool kit.

[GenoMax]

I suggest that you use reformat.sh from BBMap suite like so. It worked with your example above fine.

$ reformat.sh in=your.fq out=revcomp.fq rcomp=t

There are many other options that you can look at by just reformat.sh on command line.

[westerman]

Also look at the line above the line in question. It may be causing a problem that continues to the troublesome line.

Like GenoMax I recommend reformat.sh