Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • problem of viewing assembly data in Tablet

    Dear all:
    I want to use Tablet to view assembly data (afg file ) from velvet, but it show error messages when I import the data. Can someone tell me what is mean:
    “ an error has occurred while attempting to open the provided assembly.
    Tablet.io.ReadException:Tablet encountered a problem on line 200,968.258 of “velvet_asm.afg”.
    Error details:java.lang.NumberFormatException: Value out of range. Value:”65485” Radix:10 “.

    Thanks

  • #2
    If one of the Tablet authors doesn't spot this post, email [email protected] for help.

    Comment


    • #3
      Hi, I get the feeling (but can't be sure) that this is a malformed AFG file; possibly the quality scores given the error. If you could either strip out the relevant line from the file, or send me the whole file I could at least confirm this and see if there's anything that could be done about it.

      Comment


      • #4
        thanks a lot.
        the file is too large, so I strip some lines and post here.
        200,968,248 src:10943011
        200,968,249 off:-4
        200,968,250 clr:90,0
        200,968,251 }
        200,968,252 {TLE
        200,968,253 src:11541127
        200,968,254 off:-3
        200,968,255 clr:90,0
        200,968,256 }
        200,968,257 }
        200,968,258 {CTG
        200,968,259 iid:54
        200,968,260 eid:60-1
        200,968,261 seq:
        200,968,262 AGACTGTTTATATTAGGATTGTCAAGACACTCCGGTATTACTCGAGCCCGTAATACAACA
        200,968,263 GAGCGTCCTTAATAAATATTTCTATAAATATTTGATGTTTACCTTCCGAAAAAGGTACAT
        200,968,264 TGCCAACCTTATTTGATAAATGTGTAAACTAAGATAAGTGTTGAGATCGGATTTTGATAA
        200,968,265 AGGCATTTGTTTGGGGTGTATGAGTTGGGAAAAGAAACAACAATCATCTCTTGACCAGTT
        200,968,266 TTCCTACTACTAGTGTGTTATCATATAGCGTAAGAGTATGACATAGAGATTGAGAAACAG
        200,968,267 AAACTGAATCATAACGAACATCACAGAATTTACATTTCTACACAATTTTCAGAAAAAGTG
        200,968,268 GAGTGGTGATATATGCTTATTGTTCTACAAGTTCTCTTCATGCGTTTTTGTTTATCTATC

        Comment


        • #5
          Thanks,

          I'll look into this and get back to you.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Exploring Human Diversity Through Large-Scale Omics
            by seqadmin


            In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
            Today, 06:43 AM
          • seqadmin
            Best Practices for Single-Cell Sequencing Analysis
            by seqadmin



            While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
            06-06-2024, 07:15 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 06-21-2024, 07:49 AM
          0 responses
          15 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-20-2024, 07:23 AM
          0 responses
          16 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-17-2024, 06:54 AM
          0 responses
          18 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-14-2024, 07:24 AM
          0 responses
          28 views
          0 likes
          Last Post seqadmin  
          Working...
          X