Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • GStephen
    replied
    Thanks,

    I'll look into this and get back to you.

    Leave a comment:


  • percy
    replied
    thanks a lot.
    the file is too large, so I strip some lines and post here.
    200,968,248 src:10943011
    200,968,249 off:-4
    200,968,250 clr:90,0
    200,968,251 }
    200,968,252 {TLE
    200,968,253 src:11541127
    200,968,254 off:-3
    200,968,255 clr:90,0
    200,968,256 }
    200,968,257 }
    200,968,258 {CTG
    200,968,259 iid:54
    200,968,260 eid:60-1
    200,968,261 seq:
    200,968,262 AGACTGTTTATATTAGGATTGTCAAGACACTCCGGTATTACTCGAGCCCGTAATACAACA
    200,968,263 GAGCGTCCTTAATAAATATTTCTATAAATATTTGATGTTTACCTTCCGAAAAAGGTACAT
    200,968,264 TGCCAACCTTATTTGATAAATGTGTAAACTAAGATAAGTGTTGAGATCGGATTTTGATAA
    200,968,265 AGGCATTTGTTTGGGGTGTATGAGTTGGGAAAAGAAACAACAATCATCTCTTGACCAGTT
    200,968,266 TTCCTACTACTAGTGTGTTATCATATAGCGTAAGAGTATGACATAGAGATTGAGAAACAG
    200,968,267 AAACTGAATCATAACGAACATCACAGAATTTACATTTCTACACAATTTTCAGAAAAAGTG
    200,968,268 GAGTGGTGATATATGCTTATTGTTCTACAAGTTCTCTTCATGCGTTTTTGTTTATCTATC

    Leave a comment:


  • GStephen
    replied
    Hi, I get the feeling (but can't be sure) that this is a malformed AFG file; possibly the quality scores given the error. If you could either strip out the relevant line from the file, or send me the whole file I could at least confirm this and see if there's anything that could be done about it.

    Leave a comment:


  • maubp
    replied
    If one of the Tablet authors doesn't spot this post, email [email protected] for help.

    Leave a comment:


  • percy
    started a topic problem of viewing assembly data in Tablet

    problem of viewing assembly data in Tablet

    Dear all:
    I want to use Tablet to view assembly data (afg file ) from velvet, but it show error messages when I import the data. Can someone tell me what is mean:
    “ an error has occurred while attempting to open the provided assembly.
    Tablet.io.ReadException:Tablet encountered a problem on line 200,968.258 of “velvet_asm.afg”.
    Error details:java.lang.NumberFormatException: Value out of range. Value:”65485” Radix:10 “.

    Thanks

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 07:24 AM
0 responses
9 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 08:58 AM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
184 views
0 likes
Last Post seqadmin  
Working...
X