Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • pmiguel
    replied
    Originally posted by apredeus View Post
    That's not quite what I am wondering about.

    I have a concrete miRNA, say, hsa-miR-92a. I see certain number of reads mapping there, about 16,000, of which about 6,000 are unique mappers. Each of those reads has a unique Illumina name, and starts on the right spot (beginning of mature 3p-miRNA).

    At the same time, IGV and featureCounts recognize only about 80 of those 16,000 reads. Why could this be the case?
    Not sure if this is your issue as I've never used "featureCounts", but as far as viewing alignments, I think IGV by default down samples read alignments. You can control this behavior by choosing "View" "Preferences" and going to the "Alignments" tab. If you unclick the "Downsample reads" box, then it should show all reads that meet the map quality threshold (which can also be set on this tab.)

    --
    Phillip

    Leave a comment:


  • lre1234
    replied
    For your miR-92a example, there are two homologues of this miRNA. One is on chr13 and one on chr8. The 3p arm has the same sequence for both.

    >ID=MIMAT0000092; hsa-miR-92a-3p;Derives_from=MI0000093|13|+|92003615|92003636|
    TATTGCACTTGTCCCGGCCTGT
    --
    >ID=MIMAT0000092_1; Name=hsa-miR-92a-3p;Derives_from=MI0000094|X|-|133303574|133303595|
    TATTGCACTTGTCCCGGCCTGT

    Not sure if this fully explains the issue you are having!

    Leave a comment:


  • dpryan
    replied
    At least in some annotations, that whole cluster overlaps MIR17HG, which is a "host gene" for the whole miRNA cluster. If your annotation has that then that's why you're not getting counts.

    Leave a comment:


  • shi
    replied
    Does hsa-miR-92a overlap with other miRNAs? If a read overlaps with more than one miRNA, featureCounts wouldnt count it.

    Leave a comment:


  • apredeus
    replied
    Originally posted by shi View Post
    Most of your reads did not hit any miRNA listed in your provided annotation and therefore they were not counted by featureCounts (Unassigned_NoFeatures 17288648).

    If your annotation only includes mature miRNA, then one possible explanation for the low counting percentage is that there are a lot of precursor miRNA in your sample.
    That's not quite what I am wondering about.

    I have a concrete miRNA, say, hsa-miR-92a. I see certain number of reads mapping there, about 16,000, of which about 6,000 are unique mappers. Each of those reads has a unique Illumina name, and starts on the right spot (beginning of mature 3p-miRNA).

    At the same time, IGV and featureCounts recognize only about 80 of those 16,000 reads. Why could this be the case?

    Leave a comment:


  • shi
    replied
    Most of your reads did not hit any miRNA listed in your provided annotation and therefore they were not counted by featureCounts (Unassigned_NoFeatures 17288648).

    If your annotation only includes mature miRNA, then one possible explanation for the low counting percentage is that there are a lot of precursor miRNA in your sample.

    Leave a comment:


  • apredeus
    replied
    yeah, sure

    Status D-A1_S3_L001_R1_001.bam
    Assigned 6241430
    Unassigned_Ambiguity 209144
    Unassigned_MultiMapping 0
    Unassigned_NoFeatures 17288648
    Unassigned_Unmapped 0
    Unassigned_MappingQuality 0
    Unassigned_FragmentLength 0
    Unassigned_Chimera 0
    Unassigned_Secondary 0
    Unassigned_Nonjunction 0
    Unassigned_Duplicate 0

    Leave a comment:


  • shi
    replied
    Can you show the counting summary generated by featureCounts - you can find it in the '.summary' file generated by featureCounts?

    Leave a comment:


  • apredeus
    started a topic miRNA counting - what am I missing?

    miRNA counting - what am I missing?

    Hello all,

    I've recently tried to process few miRNA-seq experiments for our collaborators.

    The library is quite duplicated but I guess that's to be expected with miRNA; you have about 10-fold duplicate rate for most I managed to look at with FastQC

    I've got (what seems to be) the correct settings for STAR and got a fairly nice looking BAM, with some miRNAs (from miR-base) having thousands of reads according to the index. But both IGV and counting tools don't see most of those reads!

    The mapping qualities are fairly good, all the names are unique (I've looked at the specific position in the BAM file manually), and about 6 thousand have NH field set to 1! So these are unique reads that clearly align in the specified location - and yet they are ignored by both IGV and most read counters (I've tried featureCounts with multimapper option on, and RSEM so far).

    Help me out, I'm going insane here.

Latest Articles

Collapse

  • seqadmin
    The Impact of AI in Genomic Medicine
    by seqadmin



    Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
    02-26-2024, 02:07 PM
  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 06:12 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-23-2024, 04:11 PM
0 responses
64 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-21-2024, 08:52 AM
0 responses
70 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-20-2024, 08:57 AM
0 responses
60 views
0 likes
Last Post seqadmin  
Working...
X