[mmartin]

Cutadapt 1.4 released

Hi, I've just released cutadapt 1.4, which comes with some speed improvements, bug fixes and also new features. See the detailed changelog at http://code.google.com/p/cutadapt/ .

[lokapal]

I am trying to use cutadapt to remove adapters. It is some annoying that it always threw me errors when I tried to install cutadapt.
The problem seems related to C compiler. So, I removed the old ones and reinstalled windows SDKs, the version I have now is Microsoft Windows SDK for Windows 7 and .NET Framework 3.5 SP1.

I guess that you need to compile cutadapt under mingw
http://sourceforge.net/projects/mingw/, or even cygwin.
You'll be lucky if you compile it with TDM-GCC Compiler
It can be really pain in the, hmmm, head so I guess that it would be much simpler if you'll install Ubuntu 12.04.3 LTS 64bit. I've finished with this result (dualboot system, Ubuntu for all bioinformatics needs).

[ZoeG]

Hi, mmartin,

I am trying to use cutadapt to remove adapters. It is some annoying that it always threw me errors when I tried to install cutadapt.
The problem seems related to C compiler. So, I removed the old ones and reinstalled windows SDKs, the version I have now is Microsoft Windows SDK for Windows 7 and .NET Framework 3.5 SP1.
The computer is configured with windows 7, python 2.7.

However, it still threw errors after I typed 'python setup.py build' in SDK shell as showed in the end of this post. Could you give me some hints ?

>python setup.py build

running build
running build_py
running build_ext
building 'cutadapt.calign' extension
creating build\temp.win-amd64-2.7
creating build\temp.win-amd64-2.7\Release
creating build\temp.win-amd64-2.7\Release\cutadapt
C:\Program Files (x86)\Microsoft Visual Studio 9.0\VC\Bin\amd64\cl.exe /c /nolog
o /Ox /MD /W3 /GS- /DNDEBUG "-IC:\Program Files\Python\include" "-IC:\Program Fi
les\Python\PC" /Tccutadapt/calignmodule.c /Fobuild\temp.win-amd64-2.7\Release\cu
tadapt/calignmodule.obj
calignmodule.c
cutadapt/calignmodule.c(48) : warning C4005: 'max' : macro redefinition
C:\Program Files (x86)\Microsoft Visual Studio 9.0\VC\Include\stdlib.h(8
49) : see previous definition of 'max'
cutadapt/calignmodule.c(49) : warning C4005: 'min' : macro redefinition
C:\Program Files (x86)\Microsoft Visual Studio 9.0\VC\Include\stdlib.h(8
50) : see previous definition of 'min'
cutadapt/calignmodule.c(120) : error C2143: syntax error : missing ';' before '<
class-head>'
cutadapt/calignmodule.c(122) : error C2143: syntax error : missing ';' before 't
ype'
cutadapt/calignmodule.c(123) : error C2143: syntax error : missing ';' before 't
ype'
cutadapt/calignmodule.c(127) : error C2143: syntax error : missing '{' before '*
'
cutadapt/calignmodule.c(128) : error C2373: 'column' : redefinition; different t
ype modifiers
cutadapt/calignmodule.c(127) : see declaration of 'column'
cutadapt/calignmodule.c(128) : error C2059: syntax error : ')'
cutadapt/calignmodule.c(129) : error C2059: syntax error : 'if'
cutadapt/calignmodule.c(135) : error C2059: syntax error : 'for'
cutadapt/calignmodule.c(135) : error C2143: syntax error : missing '{' before '<
='
cutadapt/calignmodule.c(135) : error C2059: syntax error : '<='
cutadapt/calignmodule.c(135) : error C2059: syntax error : '++'
cutadapt/calignmodule.c(135) : error C2059: syntax error : ')'
cutadapt/calignmodule.c(141) : error C2065: 'm' : undeclared identifier
cutadapt/calignmodule.c(141) : error C2099: initializer is not a constant
cutadapt/calignmodule.c(143) : error C2065: 'm' : undeclared identifier
cutadapt/calignmodule.c(143) : error C2224: left of '.cost' must have struct/uni
on type
cutadapt/calignmodule.c(145) : error C2065: 'm' : undeclared identifier
cutadapt/calignmodule.c(145) : error C2224: left of '.origin' must have struct/u
nion type
cutadapt/calignmodule.c(148) : error C2065: 'error_rate' : undeclared identifier

cutadapt/calignmodule.c(148) : error C2065: 'm' : undeclared identifier
cutadapt/calignmodule.c(148) : error C2099: initializer is not a constant
cutadapt/calignmodule.c(149) : error C2099: initializer is not a constant
cutadapt/calignmodule.c(150) : error C2059: syntax error : 'if'
cutadapt/calignmodule.c(154) : error C2059: syntax error : 'for'
cutadapt/calignmodule.c(154) : error C2143: syntax error : missing '{' before '<
='
cutadapt/calignmodule.c(154) : error C2059: syntax error : '<='
cutadapt/calignmodule.c(154) : error C2059: syntax error : '++'
cutadapt/calignmodule.c(154) : error C2059: syntax error : ')'
cutadapt/calignmodule.c(229) : error C2059: syntax error : 'if'
cutadapt/calignmodule.c(246) : error C2371: 'free' : redefinition; different bas
ic types
C:\Program Files (x86)\Microsoft Visual Studio 9.0\VC\Include\stdlib.h(6
00) : see declaration of 'free'
cutadapt/calignmodule.c(248) : error C2059: syntax error : 'if'
cutadapt/calignmodule.c(251) : error C2059: syntax error : 'else'
cutadapt/calignmodule.c(257) : error C2099: initializer is not a constant
cutadapt/calignmodule.c(258) : error C2059: syntax error : 'return'
cutadapt/calignmodule.c(259) : error C2059: syntax error : '}'
cutadapt/calignmodule.c(297) : error C2065: 'methods' : undeclared identifier
cutadapt/calignmodule.c(297) : warning C4047: 'function' : 'PyMethodDef *' diffe
rs in levels of indirection from 'int'
cutadapt/calignmodule.c(297) : warning C4024: 'Py_InitModule4_64' : different ty
pes for formal and actual parameter 2
error: command 'cl.exe' failed with exit status 2

[Basecaller]

Trimming two adapters simultaneously can be achieved by using the --times 2 option. This is not 100% the same as specifying an "adapter pair", which is not implemented, yet, see http://code.google.com/p/cutadapt/issues/detail?id=34 . In practice, using --times 2 should give very similar results.

Thank you very much! I will try this on my samples!

[mmartin]

Trimming two adapters simultaneously can be achieved by using the --times 2 option. This is not 100% the same as specifying an "adapter pair", which is not implemented, yet, see http://code.google.com/p/cutadapt/issues/detail?id=34 . In practice, using --times 2 should give very similar results.

[Basecaller]

Dear mmartin,

I am dealing with paired-end Illumina data and I want to cut primers from both sides. When I use the command to cut both at the same time, cutadapt will just do it for one side. I tried several option, but not succesful yet. If I apply the commands seperately for the adapters, then it cuts perfect. What am I doing wrong and how can I manage to do both steps at once? Thanks a lot!

[fkrueger]

Alright done. After all its a good way to quickly simulate adapter contaminated reads and then clean them up with Cutadapt straight away... :P

[mmartin]

Great, that’s the best solution I think.

[fkrueger]

Thanks for clearing this up so quickly. The output is actually from our FastQ simulator Sherman, so I might just change it in there so that it doesn't clash with a (near enough) FastQ format specification.

Cheers,
Felix

[mmartin]

Hello Felix,

Is there a reason that lines 1 and 3 have to be identical? Isn't line 3 often just a '+' in order to save space?

Yes, having an empty description is allowed, too. Perhaps the message may be a bit misleading. I’ve now changed it to: “The second sequence description must be either empty or equal to the first description.”

In both http://dx.doi.org/10.1093.nar.gkp1137 and http://maq.sourceforge.net/fastq.shtml , which are the closest thing to a FASTQ format specification, it is stated that the second description must be the same as the first or be omitted. In short, cutadapt is correct in telling you that the file is broken. There is no option in cutadapt, yet, to ignore this error, but you can simply remove the check from the source code. In cutadapt/seqio.py, search for these lines (should be around line 318):

self.twoheaders = True
if not line[1:] == name:

and change them to:

self.twoheaders = False
if False:

With these changes, the second description is discarded by cutadapt and your output FASTQ will not have them.

btw 'sra-fastq' won't work in this case, either

That part of the message is actually incorrect and I’ve already removed it in cutadapt 1.2.

[fkrueger]

Hi Marcel,

First of all I meant to say thanks very much for Cutadapt, it is such a neat and useful tool! I was just trying to trim a FastQ file for which lines 1 and 3 do not have the same description:

@1_X:42118728-42118811_R1
ATTTTGAAATTATATATTTATTAAATAATAAAAATAAATTGAGAAGGTTATTTATGTATAGATAATGTATAGATATAAATATAGATCTAGATATTTTTAG
+1_R1
HHHHHHHHHHHHHHHHHHHHHHHHHHGGGGGGGGGGGFFFFFFFEEEEEDDDDCCCBBBAAA@@@??>>==<<;;::99877655432210/..-,+*)(

This produces the following message:

Error: At line 3: Two sequence descriptions are given in the FASTQ file, but they don't match ('1_X:42118728-42118811_R1' != '1_R1') perhaps you should try the 'sra-fastq' format?

Is there a reason that lines 1 and 3 have to be identical? Isn't line 3 often just a '+' in order to save space? (btw 'sra-fastq' won't work in this case, either).

Thanks,
Felix

[carmeyeii]

OK, good to know. Thanks,, mmartin!

[mmartin]

3' ends that have a bad quality can be removed with the -q option, but that does not remove a fixed number of bases (see the --help) and also does not work for 5' ends. In any case, cutadapt always converts csfasta/qual files to FASTQ format.

[carmeyeii]

Hello,

Does cutadapt have the option to simply trim an n number of bases from the 5' or 3' end, as specified by the user?

I do not wish to remove adaptors, but to remove bases from the reads due to quality concerns. Is there any tool, if cutadapt is not suitable, that will do it for both .csfasta and .qual files?

Thanks a lot,

carmen

[mmartin]

Hello, I've just released cutadapt 1.2. As always, get it from http://code.google.com/p/cutadapt/ or simply via "easy_install cutadapt". This is a copy of the list of changes:

• At least 25% faster processing of .csfasta/.qual files due to faster parser.
• Between 10% and 30% faster writing of gzip-compressed output files.
• Support 5' adapters in color space, even when no primer trimming is requested.
• The "--info-file" option has been added. Use this to write further information about the found adapters in each read to a separate file.
• Named adapters are now possible. Use "-a My_Adapter=ACCGTA" to assign the name "My_adapter" to an adapter.
• Improved the alignment algorithm for better poly-A trimming when there are sequencing errors. Previously, not the longest possible poly-A tail would be trimmed.
• James Casbon contributed the --discard-untrimmed option.