Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • error in the location of chromosomes (bam files) - ncRNA ref (alignament tophat)

    Hello

    I made an alignment with ncRNA.fasta sequence by Ensembl using tophat. however... in my output the trancript_ID stay in the chr local... So when I tried to run ht-seq count none sequence is found..

    Why does it happen? there is a way to change information for chromosome or be compatible with ht-seq?

    please, someone can help me??!!





    HWI-7001432L:176:C8DRKANXX:6:2102:9302:3530 pUr1s ENSSSCT00000001325.2 5 1 76M * 0 0 GCCACCGCGGTTCGCGGTTCTAAACTCTCCATCCATTCGCCTCGACTCCGCTTCTCTCCAGACTCCGAGGCTGAGG BGGGGGFGGGGGGGDGDGGEGDGGGGGGGGGEGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCCCCC AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:76 YT:Z:UU NH:i:3 CC:Z:ENSSSCT00000001326.2 CP:i:5 HI:i:0 HWI-7001432L:176:C8DRKANXX:2:1214:8451:68280 353 ENSSSCT00000000705.2 606 1 76M = 788 258 CTAAGTTTTCTTTCTTCTGGTTGGGATTATCATGGGATCCATCTGGCCAAAGGTGGCTGTGGGAAGATGGCACGCT BCCBCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGCGDFGGGGGGGGGGGGGGFGGEGGGGGGGG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:76 YT:Z:UU NH:i:4 CC:Z:ENSSSCT00000033566.1 CP:i:641 HI:i:0

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    Yesterday, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 07:15 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
15 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
9 views
0 likes
Last Post seqadmin  
Working...
X