Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bug with eXpress: Unable to open input SAM file

    Dear all ,
    I tried to use eXpress to count the mapping results obtained with Bowtie2.

    The command used is
    express -m 450 -s 100 --no-update-check transcriptome.fasta MT121_3_sorted.bam

    however I obtain the following error message when I used a BAM file as input:
    2016-Oct-21 23:34:59 - Attempting to read 'MT121_3_sorted.bam' in BAM format...
    2016-Oct-21 23:34:59 - Input is not in BAM format. Trying SAM...
    2016-Oct-21 23:34:59 - SEVERE: Unable to open input SAM file '/MT100_3.sam'.

    and this one if I use a SAM file as input
    2016-Oct-24 21:01:27 - SEVERE: Unable to open input SAM file '/MT121_3_sorted.sam'.
    2016-Oct-24 21:01:27 - Attempting to read '/MT121_3_sorted.sam' in BAM format...
    2016-Oct-24 21:01:27 - Input is not in BAM format. Trying SAM...

    The sam look like a reel SAM :
    @HD VN:1.0 SO:coordinate
    @SQ SN:c1_g1_i1 LN:241
    @SQ SN:c1_g2_i1 LN:279
    @SQ SN:c2_g1_i1 LN:319
    @SQ SN:c2_g2_i1 LN:222
    @SQ SN:c3_g1_i1 LN:642
    @SQ SN:c4_g1_i1 LN:323
    @SQ SN:c5_g1_i1 LN:234
    @SQ SN:c6_g1_i1 LN:396
    @SQ SN:c6_g2_i1 LN:351
    @SQ SN:c8_g1_i1 LN:334
    @SQ SN:c9_g1_i1 LN:214
    @SQ SN:c10_g1_i1 LN:300
    @SQ SN:c11_g1_i1 LN:432
    @SQ SN:c12_g1_i1 LN:254
    @SQ SN:c13_g1_i1 LN:282
    @SQ SN:c15_g1_i1 LN:563
    ......
    @SQ SN:c79885_g1_i1 LN:204
    @SQ SN:c79886_g1_i1 LN:243
    @PG ID:bowtie2 PN:bowtie2 VN:2.1.0
    ...
    HWI-ST909:410:C8P7RACXX:6:1203:6648:51518 147 c1_g2_i1 136 40 100M = 100 -136 ACTCTGATATTCTCTGCATCCACTGTAAATGTTCATCATTGGCACATGTT
    CCCGCAGAATTGCTGGGGCCTCTTTTGTGTCTGTATGGATCCAAATTAAT <FFFFBFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFIIFFIIIIIIIIIIIFIIIIFIIIIIIIIIIIIIIIIIIIIFFFFFFFFFFBBB AS:i:-10 XN:i:0 XM:i:285XO:i:01 XG:i:0 NM:i:2 MD:Z:9C84G5 YS:i:-18 YT:Z:CP
    HWI-ST909:410:C8P7RACXX:6:1304:8532:81357 147 c1_g2_i1 144 42 100M = 24 -220 ATTCTCTGCATCCACTGTAAATGTTCATCATTGGCACATGTTCCCGCAGA
    ATTGCTGGGGCCTCTTTTGTGTCTGTATGGATCCAAATTAATATGTTCTT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFIIIIIIFFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFFFFFFFFFFBBB AS:i:-11 XN:i:0 XM:i:286XO:i:01 XG:i:0 NM:i:2 MD:Z:1C84G13 YS:i:-11 YT:Z:CP
    HWI-ST909:410:C8P7RACXX:6:2106:12948:92662 99 c4_g1_i1 53 42 100M = 100 147 GTCAGACTTAGACGATGAGTACCTGAGATTATTTTTGTAGTATTTGATGT
    CAGATCCACCTCTGACCCAGCCAATCTTCTTCTGCTGAGCATTTTTCTCA BBBFFFFFFFFFFIIIIIIFIIIIIIIIIIIIIIIIIFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFFFFFFFFFFFFFFFFFFFFFFFFFFB AS:i:-6 XN
    :i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:72G27 YS:i:-6 YT:Z:CP
    HWI-ST909:410:C8P7RACXX:6:2211:7081:59369 69 c4_g1_i1 69 0 * = 69 0 GGTAGTCCTGTAAATCTGTGTAAGTATAGGGATAACAATGTGCAAAGTAG
    ACTGTATCGTTATNGTGCTGGAAATCTACAGTCCACGTTAGGGAGTAGAA BBBFFFFFFFFFFIIIIIIFIFIIIIIIIIIIIIIIIIIIFIIIFIIFIIIIIIFFIIIFIII#0<FFIIIIIIIFIIFFFFFFFFFFFFFFFFFBBFBF YT:Z:UP
    HWI-ST909:410:C8P7RACXX:6:2211:7081:59369 153 c4_g1_i1 69 42 100M = 69 0 GAGTACCTGAGATTATTTTTGTAGTATTTGATGTCAGATCCACCTCTGAC
    CCAGCCAATCTTCTTCTGCTGAGCATTTTTCTCACTGTACACCAGAGGCC FFFBBBBFFFFFFFFFFFFFFFFFFFFFFFFIIIFIIIIIFBIIIIIFFFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIIFIIIFFFFFFFFFFBBB AS:i:-6 XN
    :i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:56G43 YT:Z:UP
    HWI-ST909:410:C8P7RACXX:6:2106:12948:92662 147 c4_g1_i1 100 42 100M = 53 -147 TGTCAGATCCACCTCTGACCCAGCCAATCTTCTTCTGCTGAGCATTTTTC
    TCACTGTACACCAGAGGCCTCATTCCACAGTTATATAAACTGTCAGGCTT BFFFFFBBFBBFFFFFFFFFFFFFFIIIIIIIFIIIIIIIIIIIIIIIFFIIIIIIIIFFIIIIIIIIIIIIIIIIFIIIIIIIIIIFFFFFFFFFFBBB AS:i:-6 XN
    :i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:25G74 YS:i:-6 YT:Z:CP

    Does anyone have an idea to solve this problem ?

    Best regards,
    Jeremie

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
26 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
45 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
59 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
46 views
0 likes
Last Post seqadmin  
Working...
X