Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bug with eXpress: Unable to open input SAM file

    Dear all ,
    I tried to use eXpress to count the mapping results obtained with Bowtie2.

    The command used is
    express -m 450 -s 100 --no-update-check transcriptome.fasta MT121_3_sorted.bam

    however I obtain the following error message when I used a BAM file as input:
    2016-Oct-21 23:34:59 - Attempting to read 'MT121_3_sorted.bam' in BAM format...
    2016-Oct-21 23:34:59 - Input is not in BAM format. Trying SAM...
    2016-Oct-21 23:34:59 - SEVERE: Unable to open input SAM file '/MT100_3.sam'.

    and this one if I use a SAM file as input
    2016-Oct-24 21:01:27 - SEVERE: Unable to open input SAM file '/MT121_3_sorted.sam'.
    2016-Oct-24 21:01:27 - Attempting to read '/MT121_3_sorted.sam' in BAM format...
    2016-Oct-24 21:01:27 - Input is not in BAM format. Trying SAM...

    The sam look like a reel SAM :
    @HD VN:1.0 SO:coordinate
    @SQ SN:c1_g1_i1 LN:241
    @SQ SN:c1_g2_i1 LN:279
    @SQ SN:c2_g1_i1 LN:319
    @SQ SN:c2_g2_i1 LN:222
    @SQ SN:c3_g1_i1 LN:642
    @SQ SN:c4_g1_i1 LN:323
    @SQ SN:c5_g1_i1 LN:234
    @SQ SN:c6_g1_i1 LN:396
    @SQ SN:c6_g2_i1 LN:351
    @SQ SN:c8_g1_i1 LN:334
    @SQ SN:c9_g1_i1 LN:214
    @SQ SN:c10_g1_i1 LN:300
    @SQ SN:c11_g1_i1 LN:432
    @SQ SN:c12_g1_i1 LN:254
    @SQ SN:c13_g1_i1 LN:282
    @SQ SN:c15_g1_i1 LN:563
    @SQ SN:c79885_g1_i1 LN:204
    @SQ SN:c79886_g1_i1 LN:243
    @PG ID:bowtie2 PN:bowtie2 VN:2.1.0
    HWI-ST909:410:C8P7RACXX:6:1203:6648:51518 147 c1_g2_i1 136 40 100M = 100 -136 ACTCTGATATTCTCTGCATCCACTGTAAATGTTCATCATTGGCACATGTT
    HWI-ST909:410:C8P7RACXX:6:1304:8532:81357 147 c1_g2_i1 144 42 100M = 24 -220 ATTCTCTGCATCCACTGTAAATGTTCATCATTGGCACATGTTCCCGCAGA
    HWI-ST909:410:C8P7RACXX:6:2106:12948:92662 99 c4_g1_i1 53 42 100M = 100 147 GTCAGACTTAGACGATGAGTACCTGAGATTATTTTTGTAGTATTTGATGT
    :i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:72G27 YS:i:-6 YT:Z:CP
    HWI-ST909:410:C8P7RACXX:6:2211:7081:59369 153 c4_g1_i1 69 42 100M = 69 0 GAGTACCTGAGATTATTTTTGTAGTATTTGATGTCAGATCCACCTCTGAC
    :i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:56G43 YT:Z:UP
    HWI-ST909:410:C8P7RACXX:6:2106:12948:92662 147 c4_g1_i1 100 42 100M = 53 -147 TGTCAGATCCACCTCTGACCCAGCCAATCTTCTTCTGCTGAGCATTTTTC
    :i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:25G74 YS:i:-6 YT:Z:CP

    Does anyone have an idea to solve this problem ?

    Best regards,

Latest Articles


  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin

    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin

    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM





Topics Statistics Last Post
Started by seqadmin, Yesterday, 01:32 PM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
Last Post seqadmin  