Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Jah123
    Junior Member
    • Nov 2016
    • 1

    Simple question regarding Primers and specifity

    Hi,

    I am an ecologist researching bats - I collected some feces of bats and I want to make sure they are coming from the species I am looking for. Inorder to do so I want to amplify a "barcode" region in the Mitochondria from the DNA in the feces. I am trying to choose the right primers for this job from two options I have:

    Leray forward primer GGWACWGGWTGAACWGTWTAYCCYCC
    Leray reverse primer TANACYTCNGGRTGNCCRAARAAYCA

    16S forward primer CGGTTGGGGTGACCTCGGA
    16S reverse primer GCTGTTATCCCTAGGGTAACT

    First I checked if they match the species I am looking for (Pipistrellus kuhlii) and if the sequence they amplify is specific to this species, sure enough I got a 100% match and the primers matched well.

    Here comes my problem, I wanted to make sure they would also amplify other species of bats incase I collected the wrong feces. So I searched for all 33 bat species that appear in my study area and downloaded their COI sequence and 16S sequence in order to see if the primers match on them.

    I am using Geneious to check this:
    I entered a sequence of the Forward primer and also the reverse primer (and choose "R.C - reverse complement selected sequence"). The primers didn't match perfectly on most species - with differences in b.p from 0-10 which is quite a lot I assume - since the primer sequence is quite short by itself. I also had quite a few times when I aligned the primers on a bat gene that the reverse primer matched before the forward primer - should that create a problem? I mean wont they be going the wrong way?

    Hope my question is clear and someone can help me
    Thanks in advance!

Latest Articles

Collapse

  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    Yesterday, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 10:04 AM
0 responses
10 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
7 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
15 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-02-2026, 11:08 AM
0 responses
31 views
0 reactions
Last Post SEQadmin2  
Working...