Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • BWA Multiple Hits

    I have been using BWA to much success, except one small issue. When I do an alignment I only get back one result per read, but I know that I should be getting more than just a single result.

    I have tried using -N and -R but my output has not changed. Could anyone give me some guidance?


  • #2
    A bit clearer

    I have narrowed it down so that I know BWA is returning only one hit per read per fasta file. I still am unsure why -N is not working as it claims to return all hits.
    I know that bowtie has an 'all' option so I may just go with bowtie instead.



    • #3
      Do you mean the -N from aln? That would not make much sense:
      -N Disable iterative search. All hits with no more than maxDiff differences will be found. This mode is much slower than the default.

      or that from sampe?
      -N INT Maximum number of alignments to output in the XA tag for disconcordant read pairs (excluding singletons). If a read has more than INT hits, the XA tag will not be written. [10]

      I guess you'll want to use -n from samse/sampe. This will still return one "main" hit but report the others in the XA tag:
      -n INT Maximum number of alignments to output in the XA tag for reads paired properly. If a read has more than INT hits, the XA tag will not be written. [3]

      looks like that for a (single end) read with 3 possible locations:
      3_32_497 16 chr2 180106465 0 48M * 0 0 CGGTGAAACCCTGTCTCTACTAAAAATACAAAAAATTAGTCAGGCATG .... XA:Z:chr13,-27690265,48M,1;chr16,-85778252,48M,1;

      Just set -n <bignumber> to get as many locations as you like and extract them with a script.


      • #4

        Yes, that was exactly what I was missing. Thank you very much!


        • #5

          I am working with 454 data.
          I try to obtain alternative Hits with the bwasw algorithm, Can somebody help, me please?


          Latest Articles


          • seqadmin
            Current Approaches to Protein Sequencing
            by seqadmin

            Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
            04-04-2024, 04:25 PM
          • seqadmin
            Strategies for Sequencing Challenging Samples
            by seqadmin

            Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
            03-22-2024, 06:39 AM





          Topics Statistics Last Post
          Started by seqadmin, 04-11-2024, 12:08 PM
          0 responses
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 10:19 PM
          0 responses
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 09:21 AM
          0 responses
          Last Post seqadmin  
          Started by seqadmin, 04-04-2024, 09:00 AM
          0 responses
          Last Post seqadmin  