Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • JacquesT
    Junior Member
    • Mar 2017
    • 4

    #1

    How can I dissect .sam files in text editor??

    Hello everyone!

    I'm new to bioinformatics.
    I have some questions about reading (eye-balling) a .sam file.

    For example:

    @SQ SN:HPV11REF LN:7931
    @SQ SN:HPV16REF LN:7846
    @SQ SN:HPV18REF LN:7857
    @SQ SN:HPV31REF LN:7906
    @SQ SN:HPV33REF LN:7909
    @SQ SN:HPV35REF LN:7879
    @SQ SN:HPV39REF LN:7833
    @SQ SN:HPV45REF LN:7858
    @SQ SN:HPV51REF LN:7808
    @SQ SN:HPV52REF LN:7942
    @SQ SN:HPV56REF LN:7845
    @SQ SN:HPV58REF LN:7824
    @SQ SN:HPV59REF LN:7896
    @SQ SN:HPV6REF LN:7996
    @SQ SN:HPV1REF LN:7816
    @SQ SN:HPV2REF LN:7860
    @SQ SN:HPV3REF LN:7820
    @SQ SN:HPV4REF LN:7353
    @SQ SN:HPV5REF LN:7746
    @SQ SN:HPV7REF LN:8027
    @SQ SN:HPV8REF LN:7654
    @SQ SN:HPV9REF LN:7434
    @SQ SN:HPV10REF LN:7919
    @SQ SN:HPV34REF LN:7723
    @SQ SN:HPV40REF LN:7909
    @SQ SN:HPV42REF LN:7917
    @SQ SN:HPV43REF LN:7975
    @SQ SN:HPV44REF LN:7833
    @SQ SN:HPV53REF LN:7859
    @SQ SN:HPV54REF LN:7759
    @SQ SN:HPV61REF LN:7989
    @SQ SN:HPV68REF LN:7822
    @SQ SN:HPV69REF LN:7700
    @SQ SN:HPV70REF LN:7905
    @SQ SN:HPV72REF LN:7989
    @SQ SN:HPV73REF LN:7700
    @SQ SN:HPV80REF LN:7427


    {BWA instruction}


    MSQ-M1307R:269:000000000-D24BN:1:1101:15163:1383 (QNAME)
    99 (FLAG)
    HPV56REF (RNAME)
    6262 (Position of the leftmost base)
    60 (Mapping quality, Phred)
    151M (CIGAR)
    = (Mate Reference sequence NaMe (`=' if same as RNAME) )
    6268 (1-based Mate POSition)
    157 ( inferred Template LENgth (insert size))

    ACATTGTACAATCCACCTGTAAATATCCTGACTATTTAAAAATGTCTGCAGATGCCTATGGTGATTCTATGTGGTTTTACTTACGCAGGGAACAATTATTTGCCAGACATTATTTTAATAGGGCTGGTAAAGTTGGGGAAACAATACCTGC

    BCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHGHGHHHHHHGGGGGGGHGHHHHHHHHHHHHGHGHHHHHHHHHHHHHHHHHGGFHGHHHHHHGGGGHHHHHHHHHHH

    NM:i:0 (OPTional fields in the format “ TAG:VTYPE:VALUE”)

    MD:Z:151

    AS:i:151

    XS:i:0


    In this first read of the sam file, I pressed "Enter" when seeing a "Tabulation", for better understanding each part.

    Now, my question is about the following (copied) line (that you can find above):
    = (Mate Reference sequence NaMe (`=' if same as RNAME) )

    Does this mean: "if it were not '=' but 'gene X', then 'gene X' is contiguous to 'HPV56REF'(RNAME)." ???

    Thank you so much for your precious help!!

    Jacques T
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Have you checked out SAM format specification?

    Comment

    • JacquesT
      Junior Member
      • Mar 2017
      • 4

      #3
      Thanks GenoMax!!!

      No I didn't look at that .pdf

      Still, tell me if I am wrong:
      In "Ref. name of the mate/next read": "next read", does it mean the one encompassing 2 genes if RNAME is not "="?

      Comment

      • mastal
        Senior Member
        • Mar 2009
        • 666

        #4
        Mate Reference Sequence will not be '=' if the mate maps to a different contig or chromosome (the sequences listed with @SQ at the start of the sam file).

        Occasionally you get read pairs where the 2 reads of the pair map to different chromosomes.

        Comment

        • JacquesT
          Junior Member
          • Mar 2017
          • 4

          #5
          OK. It's clearer now. Thanks Mastal

          Just in case I didn't understand, I have a dumb question: each read and its mate read are from the same sequence, except that one is forward and the other is reverse. Right?

          Comment

          • mastal
            Senior Member
            • Mar 2009
            • 666

            #6
            Yes, each read and its mate are from the same fragment, starting from different ends of the fragment.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
              by SEQadmin2



              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

              Despite this, “CRISPR helped turn genome editing from a specialized technique into
              ...
              07-31-2026, 11:01 AM
            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM
            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 08-06-2026, 07:41 AM
            0 responses
            13 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-03-2026, 10:13 AM
            0 responses
            31 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-31-2026, 02:55 AM
            0 responses
            40 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-24-2026, 12:17 PM
            0 responses
            26 views
            0 reactions
            Last Post SEQadmin2  
            Working...