Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • mslider
    Junior Member
    • Sep 2010
    • 25

    Trimmomatic vs bbduk.sh

    --Hi,

    i have a big difference between results using bbduk.sh and trimmomatic trimming single-end reads, i have used the commands below, trimmomatic kept 99.78% survival reads whereas bbduk 91.76%. I don't know which to consider good or not.
    Which parameters do you use to use to trim in a good way single-reads ?

    thank you --

    java -Xmx10g -jar trimmomatic-0.36.jar SE -threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:TruSeq3-SE.fa:2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

    TrimmomaticSE: Started with arguments:
    -threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:/home/jtazi/save/Trimmomatic-0.36/adapters/TruSeq3-SE.fa:
    2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
    Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
    Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
    ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Reads: 49512700 Surviving: 49401731 (99.78%) Dropped: 110969 (0.22%)

    bbduk.sh Xmx8g in=D3_464_S2_L001_R1_001.fastq.gz out=D3_464_S2_L001_R1_001_trimmed.fastq.gz ref=resources/adapters.fa threads=8 k=13 ktrim=r useshortkmers=t mink=5 qtrim=rl minlength=36 trimq=27

    BBDuk version 36.11
    Set threads to 8
    maskMiddle was disabled because useShortKmers=true
    Initial:
    Memory: max=8232m, free=7974m, used=258m

    Added 2017 kmers; time: 0.570 seconds.
    Memory: max=8232m, free=7545m, used=687m

    Input is being processed as unpaired
    Started output streams: 0.449 seconds.
    Processing time: 118.446 seconds.

    Input: 49512700 reads 2475635000 bases.
    QTrimmed: 7288815 reads (14.72%) 218452414 bases (8.82%)
    KTrimmed: 3125475 reads (6.31%) 23413723 bases (0.95%)
    Total Removed: 4077445 reads (8.24%) 241866137 bases (9.77%)
    Result: 45435255 reads (91.76%) 2233768863 bases (90.23%)

    Time: 119.548 seconds.
    Reads Processed: 49512k 414.16k reads/sec
    Bases Processed: 2475m 20.71m bases/sec
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    See answer here.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM
    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 10:26 AM
    0 responses
    13 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    26 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    16 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-07-2026, 11:05 AM
    0 responses
    33 views
    0 reactions
    Last Post SEQadmin2  
    Working...