Retrieving single bases of the reference genome in R

[mixter]

Hello,

Given a chromsome and single-base position for a species, I need to retrieve the called base in the reference genome. I'm looking for an existing way with R/Bioconductor for this.

I am looking at the bioconductor package rtracklayer, which I know can already retrieve existing annotations (e.g. UCSC) in R-readable format. For now, I have been able to retrieve start and end of transcript and CDS for genes associated with genomic positions, but not single nucleotides at a specific position.

Otherwise, I'm thinking about reading and retrieving the reference base called directly from the reference genome in fasta (.fa) format.

Any already existing easy method would be appreciated, however.

[frozenlyse]

What you are after are the BSgenome bioconductor packages, for example using hg18

> library(BSgenome.Hsapiens.UCSC.hg18)
Loading required package: BSgenome
Loading required package: IRanges

Attaching package: 'IRanges'

The following object(s) are masked from 'package:base':

    cbind, Map, mapply, order, paste, pmax, pmax.int, pmin, pmin.int,
    rbind, rep.int, table

Loading required package: GenomicRanges
Loading required package: Biostrings
> getSeq(Hsapiens, "chr1", 10000, 10100)
[1] "CCCAGGGGCCAGCACTGCTCGAAATGTACAGCATTTCTCTTTGTAACAGGATTATTAGCCTGCTGTGCCCGGGGAAAACATGCAGCACAGTGCATCTCGAG"
>

The getSeq() function takes lots of types of arguments for specifying which regions of the genome you want to access eg vectors (as in my example), GRanges, RangedData etc