Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • H_asma
    Junior Member
    • Dec 2017
    • 1

    #1

    perl_script

    Hi everyone

    Can anyone help me in writing a perl script.
    I have a file which looks like this.
    --
    >Tm1_MAana3:scaffold_13340:12174358-12174418_2L_20123635_20123694\n
    CGTCCCTCACTTTGCCGGAAAAAGAAGTAGGGAAGTAGCTCCACTGGGGTCTCCGAAGAA\n
    >ato_REana3:scaffold_12911:1928719-1928844_3L_22432948_22433072\n
    AGTTTCTCGTGTGCCATTCGCAAAAAGCGGATTGCCCAAACCACAAACTACTTTTACCCAAAGC\n
    >wupA_IRE-0.89ana3:scaffold_13335:1723615-1724695_4_205994_207073\n
    ATCTTGTCCCGTAGTCCATGAATGTGATGTATTCCCTTACAAGGTATGCGCACTAACAC
    -----
    I want to grab chromosome name(2L in this case for first one) coordinate (20123635_20123694 in this case for first one) and name of cis regulatory module(Tm1_MA in this case for first one) and need output like this:
    chr2L 20123635 20123694 Tm1_MA
    chr3L 22432948 22433072 ato_RE
    chr4 205994 207073 wupA_IRE-0.89

    Thanks
  • SL42
    Junior Member
    • Jan 2015
    • 1

    #2
    Assuming you don't "have to" use Perl:

    You might find command line tool syntax easier for this task (I would). Looks like a grep, followed by a sed substitution, followed by an awk to me.

    Try starting from the following:

    grep ">" YourFileName | sed 's/_/\t /g' | awk '{print ... }'

    using awk to print the columns you want in the way you want (I have left that bit for you to figure out).

    You can achieve the same with command line perl, but the syntax will be quite convoluted and less easy to read.
    Last edited by SL42; 12-29-2017, 12:24 AM.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      Yesterday, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 02:55 AM
    0 responses
    8 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    12 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-23-2026, 11:41 AM
    0 responses
    12 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    24 views
    0 reactions
    Last Post SEQadmin2  
    Working...