Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • cursecatcher
    Junior Member
    • May 2018
    • 5

    #1

    Unable to intersect BAM file with bedtools

    Hi everyone, I'm trying to use bedtools intersect to check the number of mapped reads in target regions (in a .bed file) originated by targeted bisulfite sequencing experiment (EpiSeq Roche).

    I used the following command.

    Code:
    ./bedtools intersect -bed -abam sample2.bam -b 
     ~/Data/MethylSeq/dataset/Agesmoke_dataset/AgeSmkSop_all_primary_targets.bed
    The program terminate with the following message and no result at all.

    Code:
    * WARNING: File sample2.bam has inconsistent naming convention for record:
    NC_000016.9  24163386  24163537  M03971:33:000000000-BN5NL:1:2114:12003:16132/1  255  +
    
    * WARNING: File sample2.bam has inconsistent naming convention for record:
    NC_000016.9  24163386  24163537  M03971:33:000000000-BN5NL:1:2114:12003:16132/1  255  +
    I tried to modify the original SAM file removing the read that cause the problem (that was the first read in the SAM file) and the problem persists with the second read. I tried also the option -nonamecheck with no results.

    Can someone help us? Thank you.
    Nicola
  • Richard Finney
    Senior Member
    • Feb 2009
    • 701

    #2
    Check your chromosome names.
    Are they "chr" style in both bed and bam?

    Comment

    • cursecatcher
      Junior Member
      • May 2018
      • 5

      #3
      Originally posted by Richard Finney View Post
      Check your chromosome names.
      Are they "chr" style in both bed and bam?
      Hi Richard, thanks for the reply.
      About your question, I think not.

      In the bed file I have record like this:
      Code:
      chr1    11123000        11123242        chr1:11123018-11123218
      chr1    16696418        16696674        chr1:16696447-16696647
      while in the SAM file (and consequently in the BAM file) I have record like that:

      Code:
      M03971:33:000000000-BN5NL:1:2114:12003:16132    99      NC_000016.9     24163387        255     151M    =       24163431        194     TGATCGGTGGTGA
      TGGGTTAGGTAGAGTGTATTAGTTCGTTTTTATGTTGTTGATAAAGATATATTCGAGATTGTGTAATTTATGAAAAAGAGGTTTAATGGATTTGGGGAGGTTTTAATTATGGTGGAAGGTTAAAGTTATGTTTTATAT BCCCCCCBBC
      ABGGGGGGFGGGGHHHHFGGHHHHHHHHGGHGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHFHHHHGGHHHHHHHHHHHHHHHHGGFGGEHHGHHHHHHHHHHGHHHGHHHHHHHHHHHHHHHHHHH NM:i:1
        ZS:Z:++
      Ps. the SAM file is the result of an alignment with BSMAP.

      Is this the problem? How can I resolve it?
      Nicola

      Comment

      • Richard Finney
        Senior Member
        • Feb 2009
        • 701

        #4
        NC_000016 is a name used for "chr16".
        This the "official" name used at NCBI : https://www.ncbi.nlm.nih.gov/nuccore/NC_000016.10/

        You have to convert the "NCBI name" to "chr" names (or vice versa).

        There are many ways to rename fields. You can always brute force it using a custom simple program or script using your favorite programming language : bash, python, perl, C, etc.

        Any easy way would be to reheader the bam file. Please see samtools documentation for this.

        Comment

        • cursecatcher
          Junior Member
          • May 2018
          • 5

          #5
          Originally posted by Richard Finney View Post
          NC_000016 is a name used for "chr16".
          This the "official" name used at NCBI : https://www.ncbi.nlm.nih.gov/nuccore/NC_000016.10/

          You have to convert the "NCBI name" to "chr" names (or vice versa).

          There are many ways to rename fields. You can always brute force it using a custom simple program or script using your favorite programming language : bash, python, perl, C, etc.

          Any easy way would be to reheader the bam file. Please see samtools documentation for this.
          It works, thank you so much!!
          I'm sorry for the triviality of the problem, but I'm not very practical with this stuff and the bedtools message wasn't very helpful.
          Again, thank you!

          Best regards
          Nicola

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Today, 10:13 AM
          0 responses
          10 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          23 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          19 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-23-2026, 11:41 AM
          0 responses
          17 views
          0 reactions
          Last Post SEQadmin2  
          Working...