Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • HISAT2: a surprising read shows up in alignment results

    I was spot-checking the output of alignment results from HISAT2 and noticed one read (CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT shown below) that does not exist in my input fastq files. Is this the result of a bug or am I missing anything?

    $ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 409 chr19 14733987 0 76M = 14733987 0 CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT GGGGGGGGCGGGEGG>FGGGGGGBEGGGD@GEGEGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGCBCCC AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:69G6 YT:Z:UP NH:i:2
    $ zcat read1.fq.gz read2.fq.gz|grep CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT
    $ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep HISEQ:287:CCK1AANXX:5:2307:14574:99798
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 137 chr10 33189363 0 76M = 33189363 0 AAATAGTACTGTAAAAAGTGAACTGTTAAAACTAAAGGCACTTAAAACAAGAATGTGACTAGTGTGAAACAAGATG CCCBCGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGEGEG@DGGGEBGGGGGGF>GGEGGGCGGGGGGGG AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:6C69 YT:Z:UP NH:i:2
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 409 chr19 14733987 0 76M = 14733987 0 CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT GGGGGGGGCGGGEGG>FGGGGGGBEGGGD@GEGEGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGCBCCC AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:69G6 YT:Z:UP NH:i:2
    HISEQ:287:CCK1AANXX:5:2307:14574:99798 69 chr10 33189363 0 * = 33189363 0 ATAAACATACAGTGGTCTGTTATGGCACTAACTCCCCGTACTCTGCGTTGGTATCAACGCAGAGTACGGGGAGTTA 33<::BFGGGGGGGGDGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGFEGGGGGGGGGG@GGEGGGGGGGEGGGG YT:Z:UP

    The other two entries in the sam output with read name of HISEQ:287:CCK1AANXX:5:2307:14574:99798 are from my input fastq files as expected (a read pair).

    I appreciate any comments. Thanks!

  • #2
    Here's the answer (thanks to Daehwan from the HISAT2 team):
    CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT is the reverse complement of AAATAGTACTGTAAAAAGTGAACTGTTAAAACTAAAGGCACTTAAAACAAGAATGTGACTAGTGTGAAACAAGATG, which is read 1 of HISEQ:287:CCK1AANXX:5:2307:14574:99798.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Best Practices for Single-Cell Sequencing Analysis
      by seqadmin



      While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
      06-06-2024, 07:15 AM
    • seqadmin
      Latest Developments in Precision Medicine
      by seqadmin



      Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

      Somatic Genomics
      “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
      05-24-2024, 01:16 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 06-07-2024, 06:58 AM
    0 responses
    179 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-06-2024, 08:18 AM
    0 responses
    223 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-06-2024, 08:04 AM
    0 responses
    184 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-03-2024, 06:55 AM
    0 responses
    18 views
    0 likes
    Last Post seqadmin  
    Working...
    X