Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • why i have less than 50% reads surviving in pair after trimming adapters?

    Hi All.

    I'm using a ramdom amplification protocol and for library preparation I'm using Nextera XT. I'm performing seq step with Miseq reagent kit v3 600 cycles but i only use 200 cycles instead of 300 in order to get better quality score.

    After adapters trimmed with Trimmomatic I've got this result:

    TrimmomaticPE: Started with arguments:
    -phred33 -trimlog 12143_trimlog.txt 12143_R1.fastq.gz 12143_R2.fastq.gz 12143_FWP.fq.gz 12143_FWUP.fq.gz 12143_REVP.fq.gz 12143_REVUP.fq.gz ILLUMINACLIP:/home/dell/miniconda3/share/trimmomatic/adapters/NexteraPE-PE.fa:2:30:10
    Multiple cores found: Using 4 threads
    Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
    Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
    Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
    Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
    Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
    ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Read Pairs: 2764988 Both Surviving: 658763 (23.83%) Forward Only Surviving: 2105922 (76.16%) Reverse Only Surviving: 288 (0.01%) Dropped: 15 (0.00%)
    TrimmomaticPE: Completed successfully

    FastQC basic statistics for forward before triimmig
    Encoding Sanger / Illumina 1.9
    Total Sequences 2764988
    Sequences flagged as poor quality 0
    Sequence length 201
    %GC 42

    FastQC basic statistics for forward paired after triimmig
    Encoding Sanger / Illumina 1.9
    Total Sequences 658763
    Sequences flagged as poor quality 0
    Sequence length 1-201
    %GC 41
    Why I have a very low % of both surviving and why a high value for forward only?

    I really appreciate your feedbacks.


    thanks

    Chris
    Last edited by criscruz; 08-05-2018, 09:31 PM.

  • #2
    Originally posted by criscruz View Post
    <CLIP>
    Why I have a very low % of both surviving and why a high value for forward only?

    I really appreciate your feedbacks.


    thanks

    Chris
    This result indicates that your library included a large percentage of fragments with insert size less than or equal to 200bp in length. The way Trimmomatic paired end trimming operates (by default) when it finds the forward and reverse read overlap 100% (i.e. the insert is shorter than the read length) it keeps read 1 and discards read 2. The result is read 1 (forward) surviving but read 2 (reverse) not. When the overlap is only partial or not at all (i.e. insert is > 200bp) both read 1 and read 2 survive.

    Comment


    • #3
      thanks so much kmcarr

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Exploring the Dynamics of the Tumor Microenvironment
        by seqadmin




        The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
        07-08-2024, 03:19 PM
      • seqadmin
        Exploring Human Diversity Through Large-Scale Omics
        by seqadmin


        In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
        06-25-2024, 06:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Yesterday, 05:49 AM
      0 responses
      15 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-15-2024, 06:53 AM
      0 responses
      26 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-10-2024, 07:30 AM
      0 responses
      37 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-03-2024, 09:45 AM
      0 responses
      204 views
      0 likes
      Last Post seqadmin  
      Working...
      X