Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • create concatenamer of sequences

    Dear all
    I was wondering if anyone could help me in obtaining a concatenamer of sequences in the way showed below.
    I have several multifasta files relative a genes sequences (ABC, GHJ…) in different organisms (>182680572, >749299147…)

    Gene ABC
    >182680572
    ATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATA
    >749299147
    ATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCA
    >584117620
    ATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCTCACGACCTAA
    >985743106
    ATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTCCCGCCAGAAGATGTTCATACTTGGTTAAGACCTTTACAAGCCGACCAACGTGGTGACAGTGTCGTCCTTTACGCACCGAATCCCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGACGTCTTCGGGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGG



    GENE GHJ

    >182680572
    ATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATA
    >749299147
    ATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCA
    >584117620
    ATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCTCACGACCTAA
    >985743106
    ATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTCCCGCCAGAAGATGTTCATACTTGGTTAAGACCTTTACAAGCCGACCAACGTGGTGACAGTGTCGTCCTTTACGCACCGAATCCCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGACGTCTTCGGGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGG

    Then I want to obtain for each organism a concatened sequence of the genes in the same order for each organisms like below:

    >182680572
    ATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATAATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATA
    >749299147
    ATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCAATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCA
    >584117620
    ATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCTCACGACCTAAATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTTCCACCAGAAGATGTTCATACTTGGTTGAGACCTTTACAAGCTGACCAACGCGGTGACAGTGTCATCCTTTACGCACCCAATACCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGGCGTCTTCGAGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCTCACGACCTAA
    >985743106
    ATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTCCCGCCAGAAGATGTTCATACTTGGTTAAGACCTTTACAAGCCGACCAACGTGGTGACAGTGTCGTCCTTTACGCACCGAATCCCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGACGTCTTCGGGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGGATGACAACATTGATGGAATCTTGGTCCCGTTGCCTGGAACGTCTTGAAACTGAATTCCCGCCAGAAGATGTTCATACTTGGTTAAGACCTTTACAAGCCGACCAACGTGGTGACAGTGTCGTCCTTTACGCACCGAATCCCTTTATCATTGAACTAGTAGAAGAGCGATACTTAGGACGTCTTCGGGAATTGTTATCCTATTTTTCAGGAATACGTGAAGTAGTCCTTGCAATTGG

    Does anyone knows how to do it with a perl/python script or bioinformatic software?

  • #2
    Hi,

    I have similar situation, but my ID for each file is different:

    File A:
    >My_bacteriaA_GeneA
    atgatg

    >My_bacteriaB_GeneA
    atgaag

    >My_bacteriaC_GeneA
    atgatg


    File B
    >My_bacteriaB_GeneB
    atggtc

    >My_bacteriaC_GeneB
    atggtc

    >My_bacteriaA_GeneB
    atggta

    .

    .

    .
    File Z
    >My_bacteriaA_GeneZ
    atggta

    >My_bacteriaC_GeneZ
    atggta

    >My_bacteriaB_GeneZ
    atggtg

    I wish to have a concatenated fasta file that combined every core-genes for each bacteria as below to build a phylogenomic tree:

    >My_bacteriaA
    atgatg(GeneA)atggta(GeneB)...atggta(GeneZ)

    >My_bacteriaB
    atgaag(GeneA)atggtc(GeneB)...atggtg(GeneZ)

    >My_bacteriaC
    atgatg(GeneA)atggtc(GeneB)...atggta(GeneZ)

    Please note that the order each fasta file are random, not in a particular order.

    Thank you!

    Comment

    Latest Articles

    Collapse

    • seqadmin
      The Impact of AI in Genomic Medicine
      by seqadmin



      Artificial intelligence (AI) has evolved from a futuristic vision to a mainstream technology, highlighted by the introduction of tools like OpenAI's ChatGPT and Google's Gemini. In recent years, AI has become increasingly integrated into the field of genomics. This integration has enabled new scientific discoveries while simultaneously raising important ethical questions1. Interviews with two researchers at the center of this intersection provide insightful perspectives into...
      02-26-2024, 02:07 PM
    • seqadmin
      Multiomics Techniques Advancing Disease Research
      by seqadmin


      New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

      A major leap in the field has
      ...
      02-08-2024, 06:33 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Yesterday, 06:12 AM
    0 responses
    17 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-23-2024, 04:11 PM
    0 responses
    67 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-21-2024, 08:52 AM
    0 responses
    73 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-20-2024, 08:57 AM
    0 responses
    62 views
    0 likes
    Last Post seqadmin  
    Working...
    X