Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Adaper sequence to Read fastq

    Hello,

    Fairly new to bioinformatics and first time posting, hopefully I sound halfway intelligent

    My FASTQs contain adapter sequences in the read name. This adapter sequence includes a UMI. However my postprocessing software requires the UMI to be part of the read. Is there some way of inserting the adapter sequence from the read name to the beginning of the read? I'm guessing I'll also need to insert some bogus quality scores as well.

    To visualize, I need to turn this:
    @M01179:478:000000000-C33YY:1:1101:17276:1520 2:N:0:CTTGTATGTATG
    TTGTCGTTCCTTTCTTTTTGTCTCTTTCCTGTACCTCTAG
    +
    11111333@B1B11AA3A3B1A3B3BFEE333130110A0

    into this:

    @M01179:478:000000000-C33YY:1:1101:17276:1520 2:N:0:CTTGTATGTATG
    CTTGTATGTATGTTGTCGTTCCTTTCTTTTTGTCTCTTTCCTGTACCTCTAG
    +
    AAAAAAAAAAAA11111333@B1B11AA3A3B1A3B3BFEE333130110A0

    This would need to be a scriptable solution, and work on all reads from a High Out-put NextSeq run

    Thanks in advance

  • #2
    Are you sure about that? Generally in case of Illumina sequencing index sequences (which are not part of actual reads) are transferred to the fastq header as a part of demultiplexing process. That is what you are probably seeing e.g. "CTTGTATGTATG".

    Comment


    • #3
      That is correct, sequence CTTGTATGTATG is my index sequence. The first 6 bp (CTTGTA) is my sample barcode, the second 6 bp (TGTATG) is a molecular barcode. This second sequence is random, so changes across every read.

      I need to add the entire 12 bp sequence to the beginning of my read in order to utilize the UMI portion of the adapter in my alignment and variant calling software.

      Comment


      • #4
        This may be easier to do by obtaining the index read as a separate fastq file. You will also get real Q-scores for bases in index read when you do that. Stand-alone bcl2fastq allows one to get data in this format. I assume you may be able to do this using BaseSpace as well, if that is what you are using.

        You can then use a program called "Seqkit" (and specifically option "seqkit concat" to concatenate your index read in front of the actual read).

        Comment


        • #5
          Thats fantastic. This confirms by believe that there's a tool for everything.

          This does exactly what I need, with one exception. It calls the entire FastQ into memory, which is a problem when the FastQ files are 20GB each.

          I thought faidx indexing might help, but 1) bcl2fastq outputs gzip not bgzip files, and 2) my input files are FastQ and not FastA. I also thought of trying to stream the job by just providing a list of read names to concatenate using the seqkit common or grep command, but I couldn't get that to work.

          Now I'm thinking of some combination of sort, split and bash loop but I'm still a novice at linux scripting.

          Does anyone have some suggestions on how to process large files using seqkit?

          Thanks

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Exploring the Dynamics of the Tumor Microenvironment
            by seqadmin




            The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
            07-08-2024, 03:19 PM
          • seqadmin
            Exploring Human Diversity Through Large-Scale Omics
            by seqadmin


            In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
            06-25-2024, 06:43 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 07-10-2024, 07:30 AM
          0 responses
          25 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-03-2024, 09:45 AM
          0 responses
          201 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-03-2024, 08:54 AM
          0 responses
          211 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-02-2024, 03:00 PM
          0 responses
          193 views
          0 likes
          Last Post seqadmin  
          Working...
          X