Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • khb
    Member
    • Dec 2010
    • 15

    #1

    MACS SAMfiles

    Hi
    I've used MACS to find peaks in a SAM file, and I got a line in the peaks.bed file in SAM with negative start (-98) so I cannot upload the file in UCSC genome browser.
    chrM -98 4052 macs_PEAK_50677 971.81
    Does somebody understand the reason for this output? Is there a bug in MACS when it finds hits the negative strand?
    Thanks
  • polyatail
    Member
    • Dec 2010
    • 25

    #2
    Hi khb,

    What software did you use to produce the alignment? Can you post some of the reads mapping to chrM?


    Andrew

    Comment

    • khb
      Member
      • Dec 2010
      • 15

      #3
      I used bowtie.
      Here is some of the output from bowtie
      HWUSI-EAS1525_0005_FC:4:1:7582:8004#0/1 - chrM 313 CCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAA cgcag_^^^[X_LXV]ggggcfccfX_YZZQdbdb_afffdfcffggggg 0
      HWUSI-EAS1525_0005_FC:4:1:15912:8129#0/1 - chrM 14456 ATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAA afhhhfhhghhhhfhhhhhhgghhhfghghhghhhhhhhhhhhhhhhhgh 0
      HWUSI-EAS1525_0005_FC:4:1:13895:8331#0/1 + chrM 3185 ATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAA ggggcgggggffdcffdfffgggggggggggggggffgggfdafffeccd 0
      HWUSI-EAS1525_0005_FC:4:1:10583:8537#0/1 - chrM 12329 TAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTAACTTCC gfgggggggggdgggeffefaffafadde\_d^eefffafffffcebbee 0 6:G>A
      HWUSI-EAS1525_0005_FC:4:1:14677:8853#0/1 - chrM 11331 CCAACAACTTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATA ]adcffeffcffcfffcddffcfcdedeee[afcffcffcffdcffffcf 0
      HWUSI-EAS1525_0005_FC:4:1:19550:9039#0/1 + chrM 3344 TTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGC hhhhhhhhhhhghghehgghhhhhghfhghhg_hhfcfefgdfffcfdcc 0
      HWUSI-EAS1525_0005_FC:4:1:5655:9204#0/1 + chrM 13011 CCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCC hhhhhhghhhhhhhhhhhhghghhhgahgh_ffcchhhhfhchgghhh`h 0
      HWUSI-EAS1525_0005_FC:4:1:3891:9219#0/1 - chrM 12759 CATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGAT ccffdagggggddgegffgggggggggffgffffdgfecfcggggggggg 0
      HWUSI-EAS1525_0005_FC:4:1:10936:9386#0/1 - chrM 511 CCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCC c[^Y^T[T[Wb]bTbf[feeb`d_ecffdb]deeefff_fafffff`eff 0
      HWUSI-EAS1525_0005_FC:4:1:5529:9413#0/1 + chrM 595 CCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATA hhhhhhghhfhhhghhhhhhhhhhhhhhhhghhhfghhhhhhhhhhhhfh 0
      HWUSI-EAS1525_0005_FC:4:1:10410:9859#0/1 + chrM 10090 CCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTC gggfgfcffafffdff_fcfffddffffffggfggfa]fcfefcfaffec 0


      Thanks
      Last edited by khb; 12-19-2010, 10:25 PM.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
        by SEQadmin2



        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

        Despite this, “CRISPR helped turn genome editing from a specialized technique into
        ...
        Yesterday, 11:01 AM
      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Yesterday, 02:55 AM
      0 responses
      12 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      12 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      13 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      24 views
      0 reactions
      Last Post SEQadmin2  
      Working...