[apfejes]

Thanks - pileup also fits that description. Variety is the spice of life. (=

Though, just to clarify, I was just looking to point Alberto in the right direction, and had forgotten about pileup. (I don't use pileup, but I do use Picard.)

[lh3]

@Alberto Magi

What you are looking for is "pileup" (http://samtools.sourceforge.net/pileup.shtml). Please also see this page (http://samtools.sourceforge.net/pipe.shtml) about getting pileup in a specified region.

@apfejes

Pileup output is not part of Picard, you should be able to get similar things from GATK (http://www.broadinstitute.org/gsa/wi...alysis_Toolkit)

[apfejes]

That sounds suspiciously similar to a wig file, although, the format is not quite what you're expecting. I assume what you're looking for would look like:

chr1 1 0
chr2 2 1
chr2 3 1
... etc

The problem is that such file would be incredibly inefficient, hence the wig file, which will provide a more compact version. (Presumably the "variable width" format is what you're looking for.)

Although not quite the same, FindPeaks 4.0 (Yes, sorry, I'm plugging my own software) will generate fixedstep format wig files from sam/bam files, which would give you a similar result, which would look like:

fixedStep chrom=chr22 start=16653550 step=1
6
7
8
9
10
11
......

where you get a single line that tells you the start point (chr and position), and then the coverage of each position after that.

There are plenty of other wig file generators out there as well - although I'm not sure how many of them read bam/sam yet.

Cheers

[Alberto Magi]

Hi all,

i need help to obtain read depth of coverage from a .bam file. Does anybody know some tool to automatically obtain a tab-delimited file (with chromosome, position, coverage depth.....) starting from a bam file?
i wait for suggestions
thanks a lot

Alberto

[nilshomer]

Thanks, Nils; I had already tried changing the prefix, but it still seems to fail -- I'll look into it again when I have time.

Could you post your example (with a download link) to [email protected] so I can take a look?

Nils

[nilshomer]

Hi nilshomer and thanks for your reply!

I've sorted and created the indexes but the samtools message remains the same.
Any other ideas? Do you know if there exists another way to extract a particular chromosomal region from a .bam file?
Thanks,

M.

You could just run "samtools view in.bam | grep chr22" for example. Weird that your merge fails.

Nils

[Jeckow]

Hi nilshomer and thanks for your reply!

I've sorted and created the indexes but the samtools message remains the same.
Any other ideas? Do you know if there exists another way to extract a particular chromosomal region from a .bam file?
Thanks,

M.

[tgolubch]

Thanks, Nils; I had already tried changing the prefix, but it still seems to fail -- I'll look into it again when I have time.

[houhuabin]

Picard is well tested. It reports error because it is more rigorous than samtools. This error is actually a bwa problem, not picard. You may try the latest bwa-0.5.2. I believe I have fixed the issue.

Yes, I used bwa-0.5.0, bwa-0.5.2 have no such bugs at all.

Excellent wrok!!!

[nilshomer]

Hi,

I obtained complete genome sequence data in the form of “.bam” alignment files from ftp://ftp-trace.ncbi.nih.gov/1000genomes/ and I tried to extract a sub alignment of a region of chromosome 1 with the "view" command.


./samtools view -q 30 -t ../human_b36_male.fa.fai ../NA12878.SLX.maq.SRP000031.2009_08.bam chr1:150,792,101–150,884,101

I get the following:

[sam_header_read2] 114 sequences loaded.
[main_samview] random alignment retrieval only works for indexed BAM files.

Could anyone help me fix this problem? Thanks a lot.
M.

It looks like you either have not sorted the BAM file (samtools sort) or you have you have sorted the BAM file but have not created the index (samtools index).

[Jeckow]

Hi,

I obtained complete genome sequence data in the form of “.bam” alignment files from ftp://ftp-trace.ncbi.nih.gov/1000genomes/ and I tried to extract a sub alignment of a region of chromosome 1 with the "view" command.


./samtools view -q 30 -t ../human_b36_male.fa.fai ../NA12878.SLX.maq.SRP000031.2009_08.bam chr1:150,792,101–150,884,101

I get the following:

[sam_header_read2] 114 sequences loaded.
[main_samview] random alignment retrieval only works for indexed BAM files.

Could anyone help me fix this problem? Thanks a lot.
M.

[lh3]

Picard is well tested. It reports error because it is more rigorous than samtools. This error is actually a bwa problem, not picard. You may try the latest bwa-0.5.2. I believe I have fixed the issue.

[houhuabin]

hi heng
I used bwa to generate a sam file.It works well with samtools, but when I use picard ExampleSamUsage, it reprots Exception:
Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. MRNM specified but flags indicate unpaired; File e:\temp\aln.sam; Line 1
Line: >chrY_1 0 chrY 2154703 37 45M = 2154703 0 ATGGTGGCGAGCGCCTGTAGTCCCAGCTACTCGGGAGGCAGGAGA hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:45
at net.sf.samtools.SAMTextReader.reportErrorParsingLine(SAMTextReader.java:168)
at net.sf.samtools.SAMTextReader.access$500(SAMTextReader.java:40)
at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:316)
at net.sf.samtools.SAMTextReader$RecordIterator.<init>(SAMTextReader.java:202)
at net.sf.samtools.SAMTextReader$RecordIterator.<init>(SAMTextReader.java:188)
at net.sf.samtools.SAMTextReader.getIterator(SAMTextReader.java:124)
at net.sf.samtools.SAMFileReader.iterator(SAMFileReader.java:197)
at net.sf.samtools.SAMFileReader.iterator(SAMFileReader.java:39)
at net.sf.samtools.example.ExampleSamUsage.convertReadNamesToUpperCase(ExampleSamUsage.java:54)
at net.sf.samtools.example.ExampleSamUsage.main(ExampleSamUsage.java:93)
Java Result: 1
Dose picard is well tested to use now?

[nilshomer]

Is there a way to install BFAST without root access? I don't want it going into /usr/bin (and don't have access to it on the work server in any case).

Technically you can't install it to /usr/bin without root access. I assume you have a typically Unix system and you use BASH.

A useful trick to "fake" an install is to make your own "bin" directory and add the "bin" directory to your path. If your "bin" is found at "$HOME/bin", add this line to your "$HOME/.bash_profile" (assuming bash):

PATH=$PATH:/home/<username>/bin

Now you can put everyting in "$HOME/bin".

You can install BFAST in "$HOME/bin" by using the "prefix" option in the "configure" script:

./configure --prefix=$HOME

(This is not a typo, --prefix=$HOME/bin would install it in $HOME/bin/bin).
Now run:

make
make install

and everything should be installed into $HOME/bin.

Nils

[tgolubch]

Is there a way to install BFAST without root access? I don't want it going into /usr/bin (and don't have access to it on the work server in any case).