Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • KevinLam
    Senior Member
    • Nov 2009
    • 204

    #241
    Originally posted by win804 View Post
    Thanks Li Heng. I just want to confirm that nothing is wrong with the sorted bam file.

    Thanks a lot.
    You may convert to sam and count the lines as a proxy for checking.
    but yes as lh3 mentioned sorted files compress better due to the compression algorithm
    http://kevin-gattaca.blogspot.com/

    Comment

    • KevinLam
      Senior Member
      • Nov 2009
      • 204

      #242
      There was a discussion on how the CS tag should be generated in sam files according to the specs. Is there a consensus on how it is to be done?

      I have to write a script to append the CS tag info to the BWA alignment of SOLID reads. I am hoping to make it as painless as possible.
      http://kevin-gattaca.blogspot.com/

      Comment

      • bosTau2
        Member
        • Nov 2008
        • 12

        #243
        Is there sam2maq (sam to maq map format)? I am testing simulated data and like to convert ssaha2 alignment to maq output so that I can analyze them in maq. I cerated all the simu data in maq.
        Thank you.

        Comment

        • wuhoucdc
          Member
          • Oct 2009
          • 14

          #244
          Dear All,

          Do you know if samtools can perform multiple commands (>2) together? Here assuming that I have ten BAM files (result001.bam, result002.bam,......result010.bam) and want to merge them first and then sort and index them, the last step I hope is to extract the data for chromosome 1 (chr1), how can I edit the samtools command? I did it like this:
          samtools merge result.bam result001.bam result002.bam ............result010.bam |\
          samtools sort - result | \
          samtools index result.bam | \
          samtools view result.bam chr1 > resultchr1.bam

          Is it right?

          Thank you very much!

          Wu

          Comment

          • sbaheti
            Member
            • Jul 2010
            • 12

            #245
            Hi lh3

            Originally Posted by xguo
            I got a list of candidate SNPs using BWA and samtools for RNASeq data, and am trying to weigh various filtering options. "samtools.pl varFilter" gives a list of filtering criterion with default setting. The maximum read depth is set at 100. Given that duplicate reads have been removed by "samtools rmdup", do I still need to limit the maximum read depth?

            replied by lh3:
            Yes, you need this unless you are doing target sequencing in which case the read depth is expected to vary a lot.

            My question

            If we are doing variant calling in exome capture analysis, do i need to limit the max read depth when using samtool varFilter tool?

            Comment

            • bosTau2
              Member
              • Nov 2008
              • 12

              #246
              It depends on regions. If a region is repetitive then you need to filter out possible duplications which can cause artificial hetero SNPs. "Repetitive" here means kmer uniqueness --- how many times a given kmer (30mer for example) can be found in a reference.

              Comment

              • aby
                Member
                • Sep 2010
                • 25

                #247
                I was trying to convert my single read illumina file to SAM format using the export2sam.pl script. It does not work and gives the following error:

                Use of uninitialized value $t[21] in string ne at export2sam.pl line 67, <$fh1> line 14063.

                Here is a sample data from my file.

                HWUSI-EAS174_0025:2:1:5:488#0/1:CGGAGAATACGCTCCCATTCCCCCNGNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTGATCTTAGATCGGA:aabbbbb_baaa_a]ab`_aBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
                HWUSI-EAS174_0025:2:1:5:1542#0/1:TGGATGCCTAGGCAATCAGAGGCGNANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANGTGATAAGCAGCGAA:abbbabbbbbbbbbbbbbbbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB


                How do I resolve it ? Is there any other way?

                A.

                Comment

                • aby
                  Member
                  • Sep 2010
                  • 25

                  #248
                  I converted the all.map file generated from MAQ tool to SAM format using maq2sam-long in samtools. The output file I named as Out. Now when I try to convert Out file (which is in SAM format) to BAM format using the command
                  samtools view -S Out

                  I get an error message that header @ not found. When I edit the Out file by manually adding @ at the top, more errors appear. What should I do? Is there a fault in the SAM file generated by the converter maq2sam ? Is there any other way to convert SAM file to BAM file? I tried 'samtool import' and that also does not work.

                  Comment

                  • NF_seq
                    Junior Member
                    • Jun 2010
                    • 2

                    #249
                    Originally posted by NSTbioinformatics View Post
                    Question about the output of bwa?

                    I got the output, see below:
                    HWI-EAS307:1:54:758:902#0 20 19641_CLSZ1904.b1_P20.ab1_CLSZ_L._sativa_library_forward_335 301 20 36M * 0 0 CAAATCGGTGTGTTTTCACTGGTCGTGCTCGTTCCG aabaaaaaaaaababaa`aaaabaabaabbabaaaa XT:A:U NM:i:1 X0:i:1 X1:i:2 XM:i:1 XO:i:0 XG:i:0 MD:Z:35T0 XA:Z:13134_QGB27J17.yg.ab1_QGB_L._sativa_library_forward_448,-58,36M,2;7061_CLS_S3_Contig6993_CLS_S3_L._sativa_library_forward_968,-404,36M,2;

                    I can not understand the flag value 20. I used "samse" to process single reads.
                    "XT:A:U" indicates the read uniquely mapped to the reference, why i still got XA for alternative alignment inforamtion?
                    It is confused me. Someone could help me a bit for that? Thank you very much
                    It's also confused me that "XT:A:U" and "XA:..." information came up in one alignment. Could anyone please explain that? Thanks a lot! And if i only care about uniquely mapped reads, is this kind of reads what i want?

                    Comment

                    • aby
                      Member
                      • Sep 2010
                      • 25

                      #250
                      sam to bam conversion not taking place

                      samtools import example.sam example.bam

                      This command does not work. Gives error:

                      Usage: bamtk import <in.ref_list> <in.sam> <out.bam>


                      What to do? What is in.ref_list ?

                      Comment

                      • AXW
                        Junior Member
                        • Sep 2010
                        • 3

                        #251
                        Does anybody know of a utility/script for converting .SAM/BAM files into .SOAP? I know that there are scripts out there to go from SOAP->SAM, but I can't find anything going the other way.

                        Cheers.

                        Comment

                        • swbarnes2
                          Senior Member
                          • May 2008
                          • 910

                          #252
                          Originally posted by aby View Post
                          samtools import example.sam example.bam

                          This command does not work. Gives error:

                          Usage: bamtk import <in.ref_list> <in.sam> <out.bam>


                          What to do? What is in.ref_list ?
                          Use faidx to make a .fai file, use that for the in.ref.list. It works for me.

                          Comment

                          • seq_GA
                            Senior Member
                            • Feb 2009
                            • 124

                            #253
                            Hi Heng,

                            Can you please explain about the new feature of samtools (ie) multisample pile up? Thanks.

                            Comment

                            • lh3
                              Senior Member
                              • Feb 2008
                              • 686

                              #254

                              Comment

                              • aby
                                Member
                                • Sep 2010
                                • 25

                                #255
                                Okay, I have solved my problems. Seems there is a script to add the header file, and different command options for conversion to Bam.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 08-13-2026, 12:22 PM
                                0 responses
                                29 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-11-2026, 10:35 AM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-06-2026, 07:41 AM
                                0 responses
                                38 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                51 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...