[abi]

SAM to BAM problem

Parse warning at line 27: mapped sequence without CIGAR
Parse error at line 27: sequence and quality are inconsistent
Aborted



I used BWASW for alignment. Any help ??

[dpryan]

Parse warning at line 27: mapped sequence without CIGAR
Parse error at line 27: sequence and quality are inconsistent
Aborted



I used BWASW for alignment. Any help ??

Was the file truncated at that line? Otherwise it'd be helpful to see that line of the SAM file.

[abi]

No the file was not truncated at line 27. Here is the line:

0 chr4 96674301 60 227M * 0 0 TCTTTGAAACCAACGAGAACAAAGACACAACATACCAGAATCTCTGGGACACATTTAAAGCAGTGTGTAGAGGGAAATTTACAGCAGTAAATGCCCACAAGAGAATGCAGGAAAGATCTAAAATTGACACCCTAACATCAAAATTAAAAGAACTAGAGAAGCAAGAGCAATCACATTCAAAAGCTAGCAGAAGGCAAGAAATAACTAAGATCAGAGCAGAACTGAAG * NM:i:0 AS:i:227 XS:i:0


I am using bwa-0.7.4 for my alignment .

I must say that I used FASTA file for alignment and not FASTQ file. Here is a sample line from FASTA file:

> MySpecies 207
GGAGCCTTAAGGTTTGGTTATCGCCTTGTGTTTGTTTCTGGGGGTATCTGTGGGGTATGTGTTTCTGGCCATGTGTCTGTGTCTGTGTCTCTAGGCTGTCTTCTAGTCTCAGCTTGAGATCCACAGGCTTCAAGAGCTCAAGGGGGGAAAAGCCCAATTGTATATAAATTGTGAATGGGACTGATGCGTATGAGACAGGGAGGGTCT

[sbaheti]

I have seen similar issues with BWA 0.7 greater, same command runs absolutely fine with 0.7 version of BWA.

[narain]

@abi , lh3, sbaheti, dpryan, Hena and rest

I have the answer to you. There is a bug in newer versions of BWA. It does not produces right SAM files for those sequences which have their Fasta/Fastq files starting with > and a space. As an example:

This will not produce right SAM files
> My sequence

This will produce right SAM files
>My sequence


Notice the difference in space after '>'

Hope this helps. You can read more about me at www.tinyurl.com/abinarain

Cheers
Narain

[rpauly]

[samopen] SAM header is present: 84 sequences.
[sam_read1] reference '121337031' is recognized as '*'.
Parse warning at line 7932555: mapped sequence without CIGAR
Parse error at line 7932555: sequence and quality are inconsistent
Aborted (core dumped)


I am getting this error... tried the suggestion on changing the MDI in the blast2sam.pl but it is still not working!

Any suggestions will be appreciated.

[rpauly]

[samopen] SAM header is present: 84 sequences.
[sam_read1] reference '121337031' is recognized as '*'.
Parse warning at line 7932555: mapped sequence without CIGAR
Parse error at line 7932555: sequence and quality are inconsistent
Aborted (core dumped)

The suggestion to change MDI in blast2sam pl did not work! Any suggestions will be appreciated.

[TiborNagy]

Blast2Sam won't work, because it is an outdated script (I have tried it several times without success). Try to align your sequences with bwa/bowtie.