[lh3]

export2sam.pl was developed when CASAVA was not formally released (GApipeline<1.0). I do not have access to export files any more and I cannot fix the problem. Is anyone interested in maintaining this script? Thanks in advance.

In addition, I would also recommend to remap your reads with bwa/novoalign if you have the capacity. I am not familiar with the latest version of eland. But the old version was not as accurate as the best 3rd-party aligners.

[kjngo]

can someone please help me with this error in BWA/Samtools:

[samopen] SAM header is present: 89 sequences.
[sam_read1] reference '29118' is recognized as '*'.
Parse error at line 3165090: sequence and quality are inconsistent
/opt/gridengine/default/spool/compute-0-6/job_scripts/204180: line 20: 20739 Aborted (core dumped) /share/apps/samtools/samtools view -bS Tso7_Lib1_CTAG_aln.sam >Tso7_Lib1_CTAG_aln.bam
[bam_sort_core] truncated file. Continue anyway.

sorry I am new at this.

[lh3]

@kjngo

This is a known bug in bwa (not samtools). Please check out the latest SVN with:

svn co https://bio-bwa.svn.sourceforge.net/...-bwa/trunk/bwa bwa

[NSTbioinformatics]

Thank you Li Heng and Kmcarr.
I did not pay attention to the slight difference of s_N_export.txt and s_N_sorted.txt.

I will try to modify export2sam to sorted2same, hope i could find time to do so.

We are happy to the result of eland (illumina pipeline 1.5) that mapped 72.46% of unique mapped reads, while maq mapped 62.71% of unique mapped reads with the same setting of allowing at most 2 mismatches.

[kjngo]

Thank you lh3

[NSTbioinformatics]

Just modified a few lines of export2sam.pl to the new script sorted2sam.pl
sorted2sam.pl works very well to process S_N_sorted.txt (eland alignment) for single reads.
I did not test to it to parse paired end reads. It may not work well.

If someone wants to the script, please send email to [email protected]

Thank everyone for giving me some help.

By the way, i am going to the Illumina user symposim in April 27-29 in spain. I may meet someone of you there.

[luisczul]

Maq2Sam not working propertly?

Hello,

I ran the script Maq2Sam on my mapping files and the pileup file coming from the sam file is not even as close (in size and number of bases assembled) as the maq pileup file.

Does anybody know how to fix this? Or maybe another way to go from Map. files from maq to samtools?

Thanks,

[wuhoucdc]

Hi lh3,

Does SAMtools call SV currently? Thanks

Wuhoucdc

[lh3]

Try breakdancer.

[NSTbioinformatics]

Question about the output of bwa?

I got the output, see below:
HWI-EAS307:1:54:758:902#0 20 19641_CLSZ1904.b1_P20.ab1_CLSZ_L._sativa_library_forward_335 301 20 36M * 0 0 CAAATCGGTGTGTTTTCACTGGTCGTGCTCGTTCCG aabaaaaaaaaababaa`aaaabaabaabbabaaaa XT:A:U NM:i:1 X0:i:1 X1:i:2 XM:i:1 XO:i:0 XG:i:0 MD:Z:35T0 XA:Z:13134_QGB27J17.yg.ab1_QGB_L._sativa_library_forward_448,-58,36M,2;7061_CLS_S3_Contig6993_CLS_S3_L._sativa_library_forward_968,-404,36M,2;

I can not understand the flag value 20. I used "samse" to process single reads.
"XT:A:U" indicates the read uniquely mapped to the reference, why i still got XA for alternative alignment inforamtion?
It is confused me. Someone could help me a bit for that? Thank you very much

[lh3]

This read is mapped to the junction between two adjacent reference, so it gets an "unmapped" flag.

[NSTbioinformatics]

I think, "4" is the "unmapped" flag, is it right?

What is difference between flag 4 and 20?

Thank you very much.

[nilshomer]

I think, "4" is the "unmapped" flag, is it right?

What is difference between flag 4 and 20?

Thank you very much.

Use the "-X" option in "samtools view", it will probably help your interpretation of the FLAG field.

[ylc]

pick chromosome before bam sort?

A newbie question:
I can view by chromosome after a .bam file is sorted and indexed. Is it possible to extract by a chromosome number from the bam file and then do sorting and indexing? It will save time if I'm only interested in certain chromosomes and have many samples.

Thanks.

[seq_GA]

Hi,

I have few queries about samtools.

1. I am using eland mapping output and start using export2sam.pl. All the PF reads from export are being used for down stream analysis.
2. How the uniquely mapped and multiple mapped are hadled during pileup command?
3. The extended CIGAR column always shows 35M (ie the length of the read). How did the mismatch information would be incorporated? The column 15 of export contains the match descriptor information.

Thanks.