Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • gprakhar
    Member
    • Aug 2010
    • 78

    #1

    dwgsim usage

    I want to use dwgsim to generate CNVs and InDels.
    Searched for documentation, didn't find anything useful except "http://sourceforge.net/apps/mediawiki/dnaa/index.php?title=Whole_Genome_Simulation".

    Tried using it myself, its working, am getting an output, hence have some questions!

    1) "chr1 763 A C -" what does this line of output mean?
    As far as I can understand the program is taking Nucleotides from Ref Chr1, and changing them based on some parameter and then generating reads.
    In short can you please explain the algorithm behind this??

    In the output format, what is meant by "start end 1" & "start end 2" ?

    2) Why does the program produce 3 output files(2 for bwa, 1 for BFast)?

    Any help will be highly appreciated!!!
  • nilshomer
    Nils Homer
    • Nov 2008
    • 1283

    #2
    Originally posted by gprakhar View Post
    I want to use dwgsim to generate CNVs and InDels.
    Searched for documentation, didn't find anything useful except "http://sourceforge.net/apps/mediawiki/dnaa/index.php?title=Whole_Genome_Simulation".

    Tried using it myself, its working, am getting an output, hence have some questions!
    The source code is the best documentation. This simulator is forked off of the SAMtools simulator, which was modified from the MAQ simulator. It does not simulate CNVs, but only small indels, SNPs, and a single type of sequencing error (base change).

    Originally posted by gprakhar View Post
    1) "chr1 763 A C -" what does this line of output mean?
    As far as I can understand the program is taking Nucleotides from Ref Chr1, and changing them based on some parameter and then generating reads.
    In short can you please explain the algorithm behind this??
    It randomly adds SNPs and inserts/deletes bases at the given rates (-r/-R) in the given reference. The indel length is determined by an exponential distribution (-X). Then reads are simulated from this mutated genome with the given error rate (-e). Paired end reads' insert size are also drawn from an distribution. See the source code for more details.

    Originally posted by gprakhar View Post
    In the output format, what is meant by "start end 1" & "start end 2" ?
    The start positions in the reference from where the two paired end reads were drawn.

    Originally posted by gprakhar View Post
    2) Why does the program produce 3 output files(2 for bwa, 1 for BFast)?

    Any help will be highly appreciated!!!
    So we can test BWA and BFAST on the same datasets. BWA requires two files, one for each paired end, while BFAST requires an aggregated file.

    Comment

    • gprakhar
      Member
      • Aug 2010
      • 78

      #3
      Thank you for the help.
      I do agree that Source Code is the best documentation, still I will try and create a manual, as I learn about the tool.
      We have a CNV detection tool which we want to test. Hence I wanted simulated data with CNV at known locations.

      Any simulators for this particular job?

      SV simulation from the PEMer pacakage looks good, but I am having trouble compiling it.

      Comment

      • Alex8
        Member
        • Oct 2010
        • 10

        #4
        Hello, Nils,
        I have a problem obtaining color-space simulation reads.
        The output BFAST looks OK:

        @gi|12057207|gb|AE001439.1|_637443_636958_1_1_1:0:0_0:0:0_0
        A21322003132201120203003022220220001033010212331013
        +
        11111111111111111111111111111111111111111111111111
        ...

        But the two BWA files contain nucleotide reads:

        @gi|12057207|gb|AE001439.1|_637444_636959_1_1_1:0:0_0:0:0_0/2
        CTGGAATCTGGACCGAGATAATAGGGGAGGAAACATTACAGCGTTCACT
        +
        1111111111111111111111111111111111111111111111111
        ...

        Is is intended? How to get BWA files in color-space?

        Regards,
        Alexander

        Comment

        • nilshomer
          Nils Homer
          • Nov 2008
          • 1283

          #5
          Originally posted by Alex8 View Post
          Hello, Nils,
          I have a problem obtaining color-space simulation reads.
          The output BFAST looks OK:

          @gi|12057207|gb|AE001439.1|_637443_636958_1_1_1:0:0_0:0:0_0
          A21322003132201120203003022220220001033010212331013
          +
          11111111111111111111111111111111111111111111111111
          ...

          But the two BWA files contain nucleotide reads:

          @gi|12057207|gb|AE001439.1|_637444_636959_1_1_1:0:0_0:0:0_0/2
          CTGGAATCTGGACCGAGATAATAGGGGAGGAAACATTACAGCGTTCACT
          +
          1111111111111111111111111111111111111111111111111
          ...

          Is is intended? How to get BWA files in color-space?

          Regards,
          Alexander
          This is intended. The BWA reads are "double-encoded" and the input to BWA as if you had used BWA's solid2fastq.pl.

          Comment

          • Alex8
            Member
            • Oct 2010
            • 10

            #6
            I wonder what is the easy way to convert double-encoded to csfasta? SOLiD denovo tools seems to contain similar function but is is not clearly available.

            Comment

            • nilshomer
              Nils Homer
              • Nov 2008
              • 1283

              #7
              Originally posted by Alex8 View Post
              I wonder what is the easy way to convert double-encoded to csfasta? SOLiD denovo tools seems to contain similar function but is is not clearly available.
              You should use the BFAST output to convert the CSFATQ to CSFASTA/QUAL, not the BWA. The outputs of dwgsim were designed for BFAST and BWA.

              Comment

              • Alex8
                Member
                • Oct 2010
                • 10

                #8
                Thank you for the information!

                Comment

                • Alex8
                  Member
                  • Oct 2010
                  • 10

                  #9
                  Nils, please let know the format of the base/color error rate file - the one that goes with -E key.

                  Comment

                  • nilshomer
                    Nils Homer
                    • Nov 2008
                    • 1283

                    #10
                    Originally posted by Alex8 View Post
                    Nils, please let know the format of the base/color error rate file - the one that goes with -E key.
                    In the 0.1.1 release, you should have one value per line, with the ith value representing the error rate of the ith base.

                    The latest GIT, which is what I would like to support, does not use an error file, but instead uses two command line options "-e/-E" giving either a uniform error rate (ex "-e 0.01") or a increasing error rate (ex from 0.01 to 0.1 is "-e 0.01-0.1").

                    The source code is your best documentation for this software.

                    Comment

                    • arkal
                      advancing one byte at a time!
                      • Jun 2011
                      • 56

                      #11
                      Hey, I'm using dwgsim to generate paired end reads for my data. I need to generate a few single end read files as well is there any way i can use dwgsim to do the same? I don't want to use 2 different simulators for my studies.

                      -Arjun

                      Comment

                      • nilshomer
                        Nils Homer
                        • Nov 2008
                        • 1283

                        #12
                        Sure, specify zero length reads for the second end ("-2 0").

                        Comment

                        • arkal
                          advancing one byte at a time!
                          • Jun 2011
                          • 56

                          #13
                          Originally posted by nilshomer View Post
                          Sure, specify zero length reads for the second end ("-2 0").
                          Wanted to clarify that! Thanks a ton!

                          -A

                          Comment

                          • arkal
                            advancing one byte at a time!
                            • Jun 2011
                            • 56

                            #14
                            Hey i just got another doubt regarding my single end problem... if i'm setting "-2 0" then do i double the value of -N since N is the No of Read Pairs?

                            -A

                            Comment

                            • arkal
                              advancing one byte at a time!
                              • Jun 2011
                              • 56

                              #15
                              Originally posted by arkal View Post
                              Hey i just got another doubt regarding my single end problem... if i'm setting "-2 0" then do i double the value of -N since N is the No of Read Pairs?

                              -A
                              Just to clarify what i mean, supposing i need 1,000,000 read pairs for 15x coverage,
                              PE
                              -N 1000000 -1 76 -2 76

                              then is SE

                              -N 1000000 -1 76 -2 0

                              or

                              -N 2000000 -1 76 -2 0

                              ?

                              Also, if I take file 1 of PE 30X is it equivalent to SE 15X?
                              -A
                              Last edited by arkal; 07-11-2011, 11:12 PM.

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 08-06-2026, 07:41 AM
                              0 responses
                              15 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-03-2026, 10:13 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-31-2026, 02:55 AM
                              0 responses
                              41 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-24-2026, 12:17 PM
                              0 responses
                              26 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...