Would it be possible during the bcl demultiplexing specify the error/mismatch value for the index ?
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
It seems that there are lots of things that has changed with v1.8. I wish Illumina releases at least a user guide/early version of the software. We can discuss all year long and still will not get the complete picture of the new version from the release notes alone. Many centers like ours have wrappers around these software for automation.
Comment
-
Hi,
V1.8 has some extra fields:
<is filtered> is Y if the read is filtered, N otherwise.
<control number> is 0 when none of the control bits are on, otherwise it is an even number.
Does anyone know what these are for?
Is is_filtered reminiscent of QSEQ quality flag and if so does 'Y' mean high or low quality?
Colin
Comment
-
@sparks -- this is just like the 0/1 (fail/pass) in the last field old qseq files. The problem, to my knowledge is that all reads are output to the fastq.qz. Y means failed QC. Seems backwards I know...
Illumina should have a flag in the configureBclToFastq.pl script to either a) exclude non-passing filter reads or b) write them into a different fastq.gz. Otherwise you have to unzip and do filtering this via your own scripting, and this is just a waste of time...
One other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
Comment
-
Originally posted by caddymob View PostOne other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
Comment
-
Originally posted by maubp View PostOn a similar point, I'd already posted earlier on this thread that I thought removing the forward/reverse suffix (i.e. /1 or /2 at the end of the read name) and sticking this in the read description (after the space) was a bad idea.
Comment
-
Originally posted by caddymob View Post@sparks -- this is just like the 0/1 (fail/pass) in the last field old qseq files. The problem, to my knowledge is that all reads are output to the fastq.qz. Y means failed QC. Seems backwards I know...
Illumina should have a flag in the configureBclToFastq.pl script to either a) exclude non-passing filter reads or b) write them into a different fastq.gz. Otherwise you have to unzip and do filtering this via your own scripting, and this is just a waste of time...
One other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
With regard the barcode sequence it appears Illumina will have already demux'd the reads so all reads should have the same barcode. Is this correct or could we get a file with mixed index tags?
Colin
Comment
-
Couple test CASVA 1.8 fastqs with 400 reads for read 1 and read 2 attached, no QC filtering applied. Hope this helps!
Comment
-
Originally posted by caddymob View PostCouple test CASVA 1.8 fastqs with 400 reads for read 1 and read 2 attached, no QC filtering applied. Hope this helps!
Thanks for that. The reads went perfectly though not many aligned against hg36, I guess they are not human.
Novoalign now recognises the 1.8 format and has options to skip, use or QC the is_filtered='Y' reads.
Cheers, Colin
Comment
-
FASTQ quality score above 40
With the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
Comment
-
Originally posted by SeqAnswerSeeker View PostWith the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
Comment
-
Originally posted by SeqAnswerSeeker View PostWith the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
there have been some improvements to the chemistry and a refinement of the quality model. As a result, we are now starting to see Q41. There is no additional meaning behind the "J".
Thanks,
Semyon
Comment
Latest Articles
Collapse
-
by seqadmin
Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.
Somatic Genomics
“We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...-
Channel: Articles
05-24-2024, 01:16 PM -
-
by seqadmin
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...-
Channel: Articles
05-06-2024, 07:48 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Yesterday, 06:55 AM
|
0 responses
12 views
0 likes
|
Last Post
by seqadmin
Yesterday, 06:55 AM
|
||
Started by seqadmin, 05-30-2024, 03:16 PM
|
0 responses
24 views
0 likes
|
Last Post
by seqadmin
05-30-2024, 03:16 PM
|
||
Comprehensive Sequencing of Great Ape Sex Chromosomes Yields Insights into Evolution and Genetic Variability
by seqadmin
Started by seqadmin, 05-29-2024, 01:32 PM
|
0 responses
28 views
0 likes
|
Last Post
by seqadmin
05-29-2024, 01:32 PM
|
||
Started by seqadmin, 05-24-2024, 07:15 AM
|
0 responses
215 views
0 likes
|
Last Post
by seqadmin
05-24-2024, 07:15 AM
|
Comment