Would it be possible during the bcl demultiplexing specify the error/mismatch value for the index ?
Unconfigured Ad
Collapse
X
-
It seems that there are lots of things that has changed with v1.8. I wish Illumina releases at least a user guide/early version of the software. We can discuss all year long and still will not get the complete picture of the new version from the release notes alone. Many centers like ours have wrappers around these software for automation.
Comment
-
-
Hi,
V1.8 has some extra fields:
<is filtered> is Y if the read is filtered, N otherwise.
<control number> is 0 when none of the control bits are on, otherwise it is an even number.
Does anyone know what these are for?
Is is_filtered reminiscent of QSEQ quality flag and if so does 'Y' mean high or low quality?
Colin
Comment
-
-
@sparks -- this is just like the 0/1 (fail/pass) in the last field old qseq files. The problem, to my knowledge is that all reads are output to the fastq.qz. Y means failed QC. Seems backwards I know...
Illumina should have a flag in the configureBclToFastq.pl script to either a) exclude non-passing filter reads or b) write them into a different fastq.gz. Otherwise you have to unzip and do filtering this via your own scripting, and this is just a waste of time...
One other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
Comment
-
-
On a similar point, I'd already posted earlier on this thread that I thought removing the forward/reverse suffix (i.e. /1 or /2 at the end of the read name) and sticking this in the read description (after the space) was a bad idea.Originally posted by caddymob View PostOne other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
Comment
-
-
I missed that, but yes, very good point!Originally posted by maubp View PostOn a similar point, I'd already posted earlier on this thread that I thought removing the forward/reverse suffix (i.e. /1 or /2 at the end of the read name) and sticking this in the read description (after the space) was a bad idea.
Comment
-
-
Thanks for update, I'll ad a function in novoalign to filter the failed reads.Originally posted by caddymob View Post@sparks -- this is just like the 0/1 (fail/pass) in the last field old qseq files. The problem, to my knowledge is that all reads are output to the fastq.qz. Y means failed QC. Seems backwards I know...
Illumina should have a flag in the configureBclToFastq.pl script to either a) exclude non-passing filter reads or b) write them into a different fastq.gz. Otherwise you have to unzip and do filtering this via your own scripting, and this is just a waste of time...
One other thing I'll say Illumina about the format is the pass/fail and barcode string in the read header are delimited by a space. Spaces are bad! Shame! Lots of aligners will discard everything after the space.
With regard the barcode sequence it appears Illumina will have already demux'd the reads so all reads should have the same barcode. Is this correct or could we get a file with mixed index tags?
Colin
Comment
-
-
Couple test CASVA 1.8 fastqs with 400 reads for read 1 and read 2 attached, no QC filtering applied. Hope this helps!
Comment
-
-
Hi Caddymob,Originally posted by caddymob View PostCouple test CASVA 1.8 fastqs with 400 reads for read 1 and read 2 attached, no QC filtering applied. Hope this helps!
Thanks for that. The reads went perfectly though not many aligned against hg36, I guess they are not human.
Novoalign now recognises the 1.8 format and has options to skip, use or QC the is_filtered='Y' reads.
Cheers, Colin
Comment
-
-
FASTQ quality score above 40
With the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
Comment
-
-
See this: http://seqanswers.com/forums/showthread.php?t=12339Originally posted by SeqAnswerSeeker View PostWith the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
Comment
-
-
Hi Natalie,Originally posted by SeqAnswerSeeker View PostWith the new CASAVA version, base quality scores now include 41 (=J in ASCII)?
@HWI-ST750:72:B0812ABXX:5:1101:5504:2021 1:N:0:
TTGCAGGGTAGGTATAAGAGTTCTTAAAGAAAAGGAAATAGGACAACAATAAGAAGATAAGAAAAATCATTTGGACTTAAATTAGTTACATTGCTAAAGTTTCTC
+
BCCFFFFFCFHHCGHJJJIJHHIJJGJJJIJJJJJJDCGIIJJJJJJJJJJJJGHIJJJJJIJJJJIIJJIHHHHHHFFFFFFFEEEEEEEEDDDDDDDDDEEDD
Just wondering, since so far in our raw read data Phred scores ranged from 0 to 40 only.
Or is there an additional meaning behind the "J" base qual, like it was used for the stretch of "B"s at end of reads?
Thanks,
Natalie
there have been some improvements to the chemistry and a refinement of the quality model. As a result, we are now starting to see Q41. There is no additional meaning behind the "J".
Thanks,
Semyon
Comment
-
Latest Articles
Collapse
-
by SEQadmin2
Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.
The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...-
Channel: Articles
06-02-2026, 10:05 AM -
-
by SEQadmin2
With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.
Introduction
Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...-
Channel: Articles
05-22-2026, 06:42 AM -
-
by SEQadmin2
Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.
Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...-
Channel: Articles
05-06-2026, 09:04 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 06-02-2026, 12:03 PM
|
0 responses
21 views
0 reactions
|
Last Post
by SEQadmin2
06-02-2026, 12:03 PM
|
||
|
Started by SEQadmin2, 06-02-2026, 11:40 AM
|
0 responses
14 views
0 reactions
|
Last Post
by SEQadmin2
06-02-2026, 11:40 AM
|
||
|
Started by SEQadmin2, 05-28-2026, 11:40 AM
|
0 responses
29 views
0 reactions
|
Last Post
by SEQadmin2
05-28-2026, 11:40 AM
|
||
|
Started by SEQadmin2, 05-26-2026, 10:12 AM
|
0 responses
31 views
0 reactions
|
Last Post
by SEQadmin2
05-26-2026, 10:12 AM
|
Comment