Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Extract the high value column from a big file

    Hi,

    As I am new in this field. I am trying to get the best score with larger start length from below file. Here, the file header is like Chromosome location, score, and start length. I want top start length w.r.t its score and other details.

    chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1303 TGCTCAAGTACACTCATTTCA
    chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1304 GCTCAAGTACACTCATTTCAT
    chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
    chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
    chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
    chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217 AGCCAGATGCTGAGTACTATG
    chr16:21868579-21893272-|None|None 6.0 473 TTTAATGAGTATTCTGGATTG
    chr16:21868579-21893272-|None|None 6.0 5880 TTGATCCTCCCTTAACCTATC
    chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
    chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG

    I want the output like this
    chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
    chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
    chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
    chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217
    chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
    chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG


    Any help is much appreciated.


    Thanks

  • #2
    Got it

    Yahoo, I figure it out..... Anyway, any other way if we can do it then also fine...

    My Answer is sort -k1,1 -k3,3nr -k2,2n infile.txt | sort -u -k1,2 --merge

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Exploring the Dynamics of the Tumor Microenvironment
      by seqadmin




      The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
      07-08-2024, 03:19 PM
    • seqadmin
      Exploring Human Diversity Through Large-Scale Omics
      by seqadmin


      In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
      06-25-2024, 06:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Yesterday, 07:20 AM
    0 responses
    24 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-16-2024, 05:49 AM
    0 responses
    38 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-15-2024, 06:53 AM
    0 responses
    44 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-10-2024, 07:30 AM
    0 responses
    41 views
    0 likes
    Last Post seqadmin  
    Working...
    X