Extract the high value column from a big file

archana87

Junior Member

Join Date: Jul 2018

Posts: 6
- Share
- Tweet
#1

Extract the high value column from a big file

04-23-2019, 10:58 AM

Hi,

As I am new in this field. I am trying to get the best score with larger start length from below file. Here, the file header is like Chromosome location, score, and start length. I want top start length w.r.t its score and other details.

chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1303 TGCTCAAGTACACTCATTTCA
chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1304 GCTCAAGTACACTCATTTCAT
chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217 AGCCAGATGCTGAGTACTATG
chr16:21868579-21893272-|None|None 6.0 473 TTTAATGAGTATTCTGGATTG
chr16:21868579-21893272-|None|None 6.0 5880 TTGATCCTCCCTTAACCTATC
chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG

I want the output like this
chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217
chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG

Any help is much appreciated.

Thanks
Tags: None
archana87

Junior Member

Join Date: Jul 2018

Posts: 6
- Share
- Tweet
#2

04-23-2019, 01:07 PM

Got it

Yahoo, I figure it out..... Anyway, any other way if we can do it then also fine...

My Answer is sort -k1,1 -k3,3nr -k2,2n infile.txt | sort -u -k1,2 --merge
Comment

Previous template Next

Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing

by GATTACAT

Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
- Channel: Articles
07-01-2026, 11:43 AM
Nine Things a Sample Prep Scientist Thinks About Before Sequencing

by SEQadmin2

I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

Here are nine questions we think about, in roughly the order they matter, before...
- Channel: Articles
06-18-2026, 07:11 AM

Topics	Statistics	Last Post
Engineered Protein Motor Takes Its First Steps Along DNA Track by SEQadmin2 Started by SEQadmin2, Today, 11:05 AM	0 responses 7 views 0 reactions	Last Post by SEQadmin2 Today, 11:05 AM
High-Resolution Sequencing Exposes Hidden Toxoplasma Diversity by SEQadmin2 Started by SEQadmin2, 07-02-2026, 11:08 AM	0 responses 28 views 0 reactions	Last Post by SEQadmin2 07-02-2026, 11:08 AM
New AI Model Captures Long-Range Genomic Signals to Improve RNA Splice Site Prediction by SEQadmin2 Started by SEQadmin2, 06-30-2026, 05:37 AM	0 responses 27 views 0 reactions	Last Post by SEQadmin2 06-30-2026, 05:37 AM
Large-Scale Protein Screen Uncovers Hidden Regulators of Alternative Polyadenylation by SEQadmin2 Started by SEQadmin2, 06-26-2026, 11:10 AM	0 responses 26 views 0 reactions	Last Post by SEQadmin2 06-26-2026, 11:10 AM

Unconfigured Ad

Extract the high value column from a big file

Comment

Latest Articles

ad_right_rmr

News