Extract the high value column from a big file

archana87

Junior Member

Join Date: Jul 2018

Posts: 6
- Share
- Tweet
#1

Extract the high value column from a big file

04-23-2019, 10:58 AM

Hi,

As I am new in this field. I am trying to get the best score with larger start length from below file. Here, the file header is like Chromosome location, score, and start length. I want top start length w.r.t its score and other details.

chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1303 TGCTCAAGTACACTCATTTCA
chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1304 GCTCAAGTACACTCATTTCAT
chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217 AGCCAGATGCTGAGTACTATG
chr16:21868579-21893272-|None|None 6.0 473 TTTAATGAGTATTCTGGATTG
chr16:21868579-21893272-|None|None 6.0 5880 TTGATCCTCCCTTAACCTATC
chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG

I want the output like this
chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217
chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG

Any help is much appreciated.

Thanks
Tags: None
archana87

Junior Member

Join Date: Jul 2018

Posts: 6
- Share
- Tweet
#2

04-23-2019, 01:07 PM

Got it

Yahoo, I figure it out..... Anyway, any other way if we can do it then also fine...

My Answer is sort -k1,1 -k3,3nr -k2,2n infile.txt | sort -u -k1,2 --merge
Comment

Previous template Next

From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data

by SEQadmin2

Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...
- Channel: Articles
06-02-2026, 10:05 AM
Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends

by SEQadmin2

With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.

Introduction

Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
- Channel: Articles
05-22-2026, 06:42 AM

Topics	Statistics	Last Post
A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2 Started by SEQadmin2, 06-05-2026, 10:09 AM	0 responses 12 views 0 reactions	Last Post by SEQadmin2 06-05-2026, 10:09 AM
A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2 Started by SEQadmin2, 06-04-2026, 08:59 AM	0 responses 24 views 0 reactions	Last Post by SEQadmin2 06-04-2026, 08:59 AM
Long-Read RNA Sequencing Uncovers a Hidden Layer of Immune Cell Regulation by SEQadmin2 Started by SEQadmin2, 06-02-2026, 12:03 PM	0 responses 28 views 0 reactions	Last Post by SEQadmin2 06-02-2026, 12:03 PM
DNA Methylation Study Reveals How Epigenetic Changes Pass Between Generations by SEQadmin2 Started by SEQadmin2, 06-02-2026, 11:40 AM	0 responses 22 views 0 reactions	Last Post by SEQadmin2 06-02-2026, 11:40 AM

Unconfigured Ad

Extract the high value column from a big file

Comment

Latest Articles

ad_right_rmr

News