Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Cufflinks error

    When running cufflinks I get the following error:

    $ cufflinks -G annotation.gtf ./s_1/accepted_hits.bam
    cufflinks: /usr/lib64/libz.so.1: no version information available (required by cufflinks)
    Error: sort order of reads in BAMs must be the same

    I am using TopHat v1.1.4 to create the BAMs with bowtie indexes.
    The cufflinks version is cufflinks v0.9.3.

    Based on previous posts I tried reverting from the BAM to SAM, but got the same result.

    Any ideas? Thanks!

  • #2
    Same here

    I've run into the same issue...

    Comment


    • #3
      Me too

      I've had this error as well. I emailed the help email address and they said it's a rare issue with the software where the contig names have hash collisions. The problem should be fixed when they release Cufflinks v1.0.

      Comment


      • #4
        cufflinks version 1.0

        Thanks for the information. Did they mention when they would release that version?

        Comment


        • #5
          I had exactly the same problem; sorting the BAM file didn't help.

          Comment


          • #6
            Tech support was able to find the cause of my error in my SAM file. In the header section I had some colons as part of my contig names that messed up Cufflinks. By removing the colons in the header and throughout the file I stopped getting this error.
            Originally I had:
            @SQ SN:chromosome:AGPv2:1:1:301354135:1 LN:301354135
            and this changed to:
            @SQ SN:chromosome1 LN:301354135

            Hope this helps.
            Last edited by ameyer; 03-01-2011, 07:45 AM.

            Comment


            • #7
              Interesting. I checked my SAM files, and the @SQ lines only have two colons:

              @HD VN:1.0 SO:sorted
              @SQ SN:EG:bd_7x3 LN:450
              @SQ SN:EG:bd_6x3 LN:450
              @SQ SN:EG:bd_36x35 LN:554
              @SQ SN:EG:bd_55x36 LN:808
              @SQ SN:EG:bd_54x36 LN:1351
              @SQ SN:EG:bd_16x14 LN:1992
              @SQ SN:EG:bd_53x36 LN:2027
              @SQ SN:EG:bd_52x36 LN:2040
              @SQ SN:EG:bd_51x36 LN:2113
              @SQ SN:EG:bd_37x35 LN:2489
              . . .

              From your experience, is that enough to trigger the error?

              What about the reads references after that? Mine do contain a lot of colons. Did you have to modify them to? E.g.,

              @PG ID:TopHat VN:1.2.0 CL:../Applications/tophat/1.2.0/tophat -o ./2_run_TopHat/JV-
              A_on_Phatr-ENSEMBL-unmasked --num-threads 4 -G ../Data/Genome/ENSEMBL/Phaeodactylum_tricornutum.Phat
              r2.61.gtf ./1_create_Bowtie_index/Phatr-ENSEMBL-unmasked ../Data/Expression/2011.02.02/JV-A.fastq
              SNPSTER7_0744:2:33:16520:18860#0 16 EG:bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
              hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1
              SNPSTER7_0744:2:58:18789:10460#0 16 EG:bd_6x3 6 255 54M * 0 0 GGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTCG [ffffc_ccfffWcZ\Z\ZYT_NYcfaaf
              ffcfccff]fffccffffafffafc NM:i:0 NH:i:1
              . . .

              Comment


              • #8
                The only colons that are allowed in the @SQ lines are the ones directly after SN and LN so the one you have between EG and bd would have to be removed. It would also have to be removed in all the read references so that the the names match each other.
                So for example you would have:
                @SQ SN:bd_6x3 LN:450
                and:
                SNPSTER7_0744:2:33:16520:18860#0 16 bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
                hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1

                Comment


                • #9
                  It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                  Aurelien
                  Attached Files

                  Comment


                  • #10
                    Originally posted by Aurelien Mazurie View Post
                    It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                    Aurelien
                    Your script just saved my bacon. Thank you SO much for this!!!

                    Comment


                    • #11
                      COLONS in the fasta and GFF!!!!!

                      Comment

                      Latest Articles

                      Collapse

                      • seqadmin
                        Recent Advances in Sequencing Analysis Tools
                        by seqadmin


                        The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
                        05-06-2024, 07:48 AM
                      • seqadmin
                        Essential Discoveries and Tools in Epitranscriptomics
                        by seqadmin




                        The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                        04-22-2024, 07:01 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by seqadmin, 05-14-2024, 07:03 AM
                      0 responses
                      25 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 05-10-2024, 06:35 AM
                      0 responses
                      45 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 05-09-2024, 02:46 PM
                      0 responses
                      59 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 05-07-2024, 06:57 AM
                      0 responses
                      46 views
                      0 likes
                      Last Post seqadmin  
                      Working...
                      X