Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • eieneg
    replied
    COLONS in the fasta and GFF!!!!!

    Leave a comment:


  • delphi_ote
    replied
    Originally posted by Aurelien Mazurie View Post
    It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

    Aurelien
    Your script just saved my bacon. Thank you SO much for this!!!

    Leave a comment:


  • Aurelien Mazurie
    replied
    It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

    Aurelien
    Attached Files

    Leave a comment:


  • ameyer
    replied
    The only colons that are allowed in the @SQ lines are the ones directly after SN and LN so the one you have between EG and bd would have to be removed. It would also have to be removed in all the read references so that the the names match each other.
    So for example you would have:
    @SQ SN:bd_6x3 LN:450
    and:
    SNPSTER7_0744:2:33:16520:18860#0 16 bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
    hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1

    Leave a comment:


  • Aurelien Mazurie
    replied
    Interesting. I checked my SAM files, and the @SQ lines only have two colons:

    @HD VN:1.0 SO:sorted
    @SQ SN:EG:bd_7x3 LN:450
    @SQ SN:EG:bd_6x3 LN:450
    @SQ SN:EG:bd_36x35 LN:554
    @SQ SN:EG:bd_55x36 LN:808
    @SQ SN:EG:bd_54x36 LN:1351
    @SQ SN:EG:bd_16x14 LN:1992
    @SQ SN:EG:bd_53x36 LN:2027
    @SQ SN:EG:bd_52x36 LN:2040
    @SQ SN:EG:bd_51x36 LN:2113
    @SQ SN:EG:bd_37x35 LN:2489
    . . .

    From your experience, is that enough to trigger the error?

    What about the reads references after that? Mine do contain a lot of colons. Did you have to modify them to? E.g.,

    @PG ID:TopHat VN:1.2.0 CL:../Applications/tophat/1.2.0/tophat -o ./2_run_TopHat/JV-
    A_on_Phatr-ENSEMBL-unmasked --num-threads 4 -G ../Data/Genome/ENSEMBL/Phaeodactylum_tricornutum.Phat
    r2.61.gtf ./1_create_Bowtie_index/Phatr-ENSEMBL-unmasked ../Data/Expression/2011.02.02/JV-A.fastq
    SNPSTER7_0744:2:33:16520:18860#0 16 EG:bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
    hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1
    SNPSTER7_0744:2:58:18789:10460#0 16 EG:bd_6x3 6 255 54M * 0 0 GGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTCG [ffffc_ccfffWcZ\Z\ZYT_NYcfaaf
    ffcfccff]fffccffffafffafc NM:i:0 NH:i:1
    . . .

    Leave a comment:


  • ameyer
    replied
    Tech support was able to find the cause of my error in my SAM file. In the header section I had some colons as part of my contig names that messed up Cufflinks. By removing the colons in the header and throughout the file I stopped getting this error.
    Originally I had:
    @SQ SN:chromosome:AGPv2:1:1:301354135:1 LN:301354135
    and this changed to:
    @SQ SN:chromosome1 LN:301354135

    Hope this helps.
    Last edited by ameyer; 03-01-2011, 07:45 AM.

    Leave a comment:


  • Aurelien Mazurie
    replied
    I had exactly the same problem; sorting the BAM file didn't help.

    Leave a comment:


  • brachysclereid
    replied
    cufflinks version 1.0

    Thanks for the information. Did they mention when they would release that version?

    Leave a comment:


  • ameyer
    replied
    Me too

    I've had this error as well. I emailed the help email address and they said it's a rare issue with the software where the contig names have hash collisions. The problem should be fixed when they release Cufflinks v1.0.

    Leave a comment:


  • jgarbe
    replied
    Same here

    I've run into the same issue...

    Leave a comment:


  • brachysclereid
    started a topic Cufflinks error

    Cufflinks error

    When running cufflinks I get the following error:

    $ cufflinks -G annotation.gtf ./s_1/accepted_hits.bam
    cufflinks: /usr/lib64/libz.so.1: no version information available (required by cufflinks)
    Error: sort order of reads in BAMs must be the same

    I am using TopHat v1.1.4 to create the BAMs with bowtie indexes.
    The cufflinks version is cufflinks v0.9.3.

    Based on previous posts I tried reverting from the BAM to SAM, but got the same result.

    Any ideas? Thanks!

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 02:06 PM
0 responses
7 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
27 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
47 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
59 views
0 likes
Last Post seqadmin  
Working...
X