Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • brachysclereid
    Member
    • Feb 2011
    • 32

    Cufflinks error

    When running cufflinks I get the following error:

    $ cufflinks -G annotation.gtf ./s_1/accepted_hits.bam
    cufflinks: /usr/lib64/libz.so.1: no version information available (required by cufflinks)
    Error: sort order of reads in BAMs must be the same

    I am using TopHat v1.1.4 to create the BAMs with bowtie indexes.
    The cufflinks version is cufflinks v0.9.3.

    Based on previous posts I tried reverting from the BAM to SAM, but got the same result.

    Any ideas? Thanks!
  • jgarbe
    Member
    • Mar 2010
    • 14

    #2
    Same here

    I've run into the same issue...

    Comment

    • ameyer
      Member
      • Jan 2011
      • 23

      #3
      Me too

      I've had this error as well. I emailed the help email address and they said it's a rare issue with the software where the contig names have hash collisions. The problem should be fixed when they release Cufflinks v1.0.

      Comment

      • brachysclereid
        Member
        • Feb 2011
        • 32

        #4
        cufflinks version 1.0

        Thanks for the information. Did they mention when they would release that version?

        Comment

        • Aurelien Mazurie
          Member
          • Feb 2011
          • 15

          #5
          I had exactly the same problem; sorting the BAM file didn't help.

          Comment

          • ameyer
            Member
            • Jan 2011
            • 23

            #6
            Tech support was able to find the cause of my error in my SAM file. In the header section I had some colons as part of my contig names that messed up Cufflinks. By removing the colons in the header and throughout the file I stopped getting this error.
            Originally I had:
            @SQ SN:chromosome:AGPv2:1:1:301354135:1 LN:301354135
            and this changed to:
            @SQ SN:chromosome1 LN:301354135

            Hope this helps.
            Last edited by ameyer; 03-01-2011, 07:45 AM.

            Comment

            • Aurelien Mazurie
              Member
              • Feb 2011
              • 15

              #7
              Interesting. I checked my SAM files, and the @SQ lines only have two colons:

              @HD VN:1.0 SO:sorted
              @SQ SN:EG:bd_7x3 LN:450
              @SQ SN:EG:bd_6x3 LN:450
              @SQ SN:EG:bd_36x35 LN:554
              @SQ SN:EG:bd_55x36 LN:808
              @SQ SN:EG:bd_54x36 LN:1351
              @SQ SN:EG:bd_16x14 LN:1992
              @SQ SN:EG:bd_53x36 LN:2027
              @SQ SN:EG:bd_52x36 LN:2040
              @SQ SN:EG:bd_51x36 LN:2113
              @SQ SN:EG:bd_37x35 LN:2489
              . . .

              From your experience, is that enough to trigger the error?

              What about the reads references after that? Mine do contain a lot of colons. Did you have to modify them to? E.g.,

              @PG ID:TopHat VN:1.2.0 CL:../Applications/tophat/1.2.0/tophat -o ./2_run_TopHat/JV-
              A_on_Phatr-ENSEMBL-unmasked --num-threads 4 -G ../Data/Genome/ENSEMBL/Phaeodactylum_tricornutum.Phat
              r2.61.gtf ./1_create_Bowtie_index/Phatr-ENSEMBL-unmasked ../Data/Expression/2011.02.02/JV-A.fastq
              SNPSTER7_0744:2:33:16520:18860#0 16 EG:bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
              hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1
              SNPSTER7_0744:2:58:18789:10460#0 16 EG:bd_6x3 6 255 54M * 0 0 GGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTCG [ffffc_ccfffWcZ\Z\ZYT_NYcfaaf
              ffcfccff]fffccffffafffafc NM:i:0 NH:i:1
              . . .

              Comment

              • ameyer
                Member
                • Jan 2011
                • 23

                #8
                The only colons that are allowed in the @SQ lines are the ones directly after SN and LN so the one you have between EG and bd would have to be removed. It would also have to be removed in all the read references so that the the names match each other.
                So for example you would have:
                @SQ SN:bd_6x3 LN:450
                and:
                SNPSTER7_0744:2:33:16520:18860#0 16 bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
                hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1

                Comment

                • Aurelien Mazurie
                  Member
                  • Feb 2011
                  • 15

                  #9
                  It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                  Aurelien
                  Attached Files

                  Comment

                  • delphi_ote
                    Junior Member
                    • Oct 2010
                    • 9

                    #10
                    Originally posted by Aurelien Mazurie View Post
                    It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

                    Aurelien
                    Your script just saved my bacon. Thank you SO much for this!!!

                    Comment

                    • eieneg
                      Junior Member
                      • Feb 2017
                      • 5

                      #11
                      COLONS in the fasta and GFF!!!!!

                      Comment

                      Latest Articles

                      Collapse

                      • GATTACAT
                        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                        by GATTACAT
                        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                        07-01-2026, 11:43 AM
                      • SEQadmin2
                        Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                        by SEQadmin2


                        I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                        Here are nine questions we think about, in roughly the order they matter, before...
                        06-18-2026, 07:11 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, 07-02-2026, 11:08 AM
                      0 responses
                      25 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 06-30-2026, 05:37 AM
                      0 responses
                      23 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 06-26-2026, 11:10 AM
                      0 responses
                      23 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 06-17-2026, 06:09 AM
                      0 responses
                      55 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...