Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • foolishbrat
    Member
    • Nov 2008
    • 45

    About Data Format and Eland Input

    Hi all,

    I have couple of questions regarding above topic:
    1. What is the name of data format below?
    2. And can Eland take it as input?
    3. How can I convert it into FASTA?


    Code:
    4       1       998     538     GAAG...T..AA....C..T...A............
    4       1       955     536     GGGTTTGTAACTTTATTCTTTATATTAAGACTCATT
    4       1       117     123     GTTCTGGTGTCTAACTTTATTCTACCCCTAGAACAC
    4       1       899     114     GAGTTATTGGAAACAAAATTAAAACACCCATCGCTA
    4       1       958     100     GAGTGCACCTATTTATTGCCCACTGCCCTCTTTTTA
    4       1       885     618     GGTGCTTTTTAAAACGCTCCAAGTTTTAAAAGTCTT
    4       1       876     615     GTTTGATTTGAATAAAATCAAGTATCAATTTACTGA
    4       1       880     509     GGTTGTTTGCATGTGATTAAGAATCTTTTATGCATT
    4       1       911     582     GATTTCATCCATCACCAACCTCAACCACACAAACAC
    4       1       881     107     GTTTTTTTCGCTCAATTCTTTAACCATAAGCGTTTT
    4       1       40      113     GATTAAGGGTGTGTTGGGGGTGTTTTAAGGCGTAGG
    4       1       934     605     GTTTTTCTAAAGAGGGTTTTATTATTTTTCTCTTTT
    4       1       53      78      GCAGAAACGCGCTTTATGTTAAGATCTTCAAAATTG
    4       1       13      85      GCCTAGCGATATCGCTAAGGATATTGTGGTAAATCT
    4       1       777     754     GCCGTTTTTTTCTATAGTTTTGGGCATTGGTGCTGG
  • zee
    NGS specialist
    • Apr 2008
    • 249

    #2
    This looks like Solexa's SEQ format, there should be a corresponding PRB file with a value for each base, for each position, so if you had a read of 10 bases, there would be 40 values in the PRB format.

    Eland can take the PRB format as well as FASTA. If you download the MAQ package and MAQ scripts the fq_all2std.pl should take care of all your format conversion needs e.g.
    Code:
    fq_all2std.pl 
    
    Usage:   fq_all2std.pl <command> <in.txt>
    
    Command: scarf2std      Convert SCARF format to the standard/Sanger FASTQ
             fqint2std      Convert FASTQ-int format to the standard/Sanger FASTQ
             sol2std        Convert Solexa/Illumina FASTQ to the standard FASTQ
             fa2std         Convert FASTA to the standard FASTQ
             seqprb2std     Convert .seq and .prb files to the standard FASTQ
             fq2fa          Convert various FASTQ-like format to FASTA
             export2sol     Convert Solexa export format to Solexa FASTQ
             export2std     Convert Solexa export format to Sanger FASTQ
             csfa2std       Convert AB SOLiD read format to Sanger FASTQ
             instruction    Explanation to different format
             example        Show examples of various formats
    
    Note:    Read/quality sequences MUST be presented in one line.

    Comment

    • swbarnes2
      Senior Member
      • May 2008
      • 910

      #3
      Maq's seqprb2std looks like it will work...for one .prb and one seq file. GAI chips have 300 tiles per lane, newer chips 100 per lane. You'd need a wrapper torun the program mutiple times.

      Look in a thread called "Illumina's PRB file to FastQ" in 'Bioinformatics" for a Perl script that will turn .seq and .prb files info FASTQ's that'll also need tweaking if you need to keep the lanes separate.

      But to turn a raw .seq ito a fasta is pretty easy. A few lines in awk or sed, or a Perl one-liner, maybe.
      Last edited by swbarnes2; 01-22-2009, 04:51 PM. Reason: I thought I'd closed without posting

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      15 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      33 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-02-2026, 11:08 AM
      0 responses
      31 views
      0 reactions
      Last Post SEQadmin2  
      Working...