Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • smarthey
    Junior Member
    • May 2010
    • 3

    #1

    Bowtie - SOLiD : Weird decoding examples

    Hi,
    I listed below some differents and weird mapping results obtain with Bowtie 0.12.7 on solid data.
    1: SNP appearance
    Code:
    2_18_1468_F3    0    3    19908716    255    22M    *    0    0    ACCACAGGGTAGAACCACGGTC    IqqqqqqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:20A1    NM:i:1    CM:i:2
    [1]-----Read: T3101112001322010113012
    [2]--Decoded: 3101112001322010113012
    [3]Reference: 3101112001322010113012
    It's EXACTLY the same ! But the final decoded nucleotide sequence makes appear a A which is neither in the read sequence nor in the reference sequence.
    What happens here ?...

    2: Color appearance
    Code:
    2_28_457_F3    16    1    32349243    255    22M    *    0    0    CATGTCCTGCTGAATGTCTAAC    Iqq!!qqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:3C18    NM:i:1    CM:i:2
    [1]------Read: 1310202132120311223010T (reverse)
    [2]--Decoded: 131120213212031122301
    [3]Reference: 132220213212031122301
    How can I observe three different color ? The decoded nuc shouldn't be in the read or in the reference ?

    3: ????
    Code:
    2_28_457_F3    16    3    30644442    255    22M    *    0    0    CATGGAAGTAGTCCGTGAGCCA    IqqqqqqqqqqqqqqqqqqqqI    XA:i:2    MD:Z:17G0A3    NM:i:2    CM:i:2
    [1]------Read: 1310202132120311223010T (reverse)
    [2]--Decoded: 131020213212031122301
    [3]Reference: 131020213212031102101

    Is someone obtain the same kind of results ? Is it normal ? Maybe I missunderstoud the decoding colorspace step.

    [1] Original read color sequence
    [2] Decoded color sequence (from decoded nucleotide sequence)
    [3] Reference sequence color:

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 08-03-2026, 10:13 AM
0 responses
15 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
32 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
23 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-23-2026, 11:41 AM
0 responses
21 views
0 reactions
Last Post SEQadmin2  
Working...