What is the difference between sol2std and sol2sanger

[inesdesantiago]

Hello, does any one know what is the difference between these two maq scripts (both available in the latest maq version 0.7.1):

sol2sanger
sol2sanger convert Solexa FASTQ to standard/Sanger FASTQ
Usage: maq sol2sanger in.fastq out.fastq

sol2std
sol2std Convert Solexa/Illumina FastQ to the standard/Sanger FASTQ
Usage: pearl fq_all2std.pl sol2std in.txt > out.fastq

I tried both scripts with the file "_sequence.txt" that I got from the Illumina. Here are the results for the first sequence:

s_sequence.txt
@GAII01_3:8:1:136:1560
GAGTTCAATTTTGTTAATTCCTTTCTGAAAATAGAT
+GAII01_3:8:1:136:1560
WWWWWWWWWWWWWWWWWWWWWWWWWWLWWWRRRIRO

sol2sanger_s_sequence.fastq
@GAII01_3:8:1:136:1560
GAGTTCAATTTTGTTAATTCCTTTCTGAAAATAGAT
+
88888888888888888888888888-888333+30

sol2std_s_sequence.fastq
@GAII01_3:8:1:136:1560
GAGTTCAATTTTGTTAATTCCTTTCTGAAAATAGAT
+
88888888888888888888888888-888333+30!

The only difference between the fastq file generated by sol2sanger and sol2std scripts is that the sol2std writes a "!" in the end of the 4th line..
I checked, it does this in every 4th line of the file..
What does this means?
What script is the best?

Thanks!
Ines de Santiago

[regyre]

Hi,

If you run the following command:

perl fq_all2std.pl instruction

You get this output:

FASTQ format is first used in the Sanger Institute, and therefore
we take the Sanger specification as the standard FASTQ. Although
Solexa/Illumina reads file looks pretty much like the standard
FASTQ, they are different in that the qualities are scaled
differently. In the quality string, if you can see a character
with its ASCII code higher than 90, probably your file is in the
Solexa/Illumina format.

Sometimes we also use an integer, instead of a single character,
to explicitly show the qualities. In that case, negative
qualities indicates that Solexa/Illumina qualities are used.

You might find these two threads informative as well:

http://seqanswers.com/forums/showthread.php?t=468&highlight=sanger+quality

http://seqanswers.com/forums/showthread.php?t=1021&highlight=sanger+quality

Well, to answer your question, both should provide the same output. However as far as I can see, the ! is not introduced on purpose, looks more like a bug to me.

I've "annotated" the perl sol2std function of the fq_all2std.pl script (maq 0.7.1) below:

sub sol2std {
  my $max = 0;
  while (<>) {
	if (/^@/) {
	  
          # print the first entry line
          print;
	 
          # print the seq line, skip the second ID line and 
          # get the content of the quality line

	  # the actual problem is there, the carriage return 
          # char is captured as well	  
          $_ = <>; print; $_ = <>; $_ = <>;
          
          # my solution is to add this line:
          #  chomp;	  
          my @t = split('', $_);

          # here the at array contains all the quality 
          # chars + a carriage return 
 	  my $qual = '';

          # here the additional carriage return will be converted 
          # as well; therefore the ! which is introduced
	  $qual .= $conv_table[ord($_)] for (@t);
	  print "+\n$qual\n";
	}
  }
}

I hope lh3 will read this thread and can comment on it.

Therefore, I would recommand to use this for the time being

maq sol2sanger

Best,

[inesdesantiago]

thanks very much!

[malachig]

I have also encountered the trailing '!' produced by the perl sol2std function of the fq_all2std.pl script (maq 0.7.1). This causes an exception if the subsequent fastq file is fed into hmmSplicer. Thanks for the advice on using sol2sanger instead.