Header Leaderboard Ad
Collapse
bwa bug (?) leading to samtools segfault
Collapse
Announcement
Collapse
No announcement yet.
X
-
No, I haven't been able to figure it out and I got side-tracked by other problems. I'll see if I can spend a bit more time to go to the bottom of it.
-
Hi,
was wondering if you have figured out where the problem is, as I think I have
run into a similar problem, using a combination of samtools 'merge' and 'reheader'.
I think there is a bug in 'samtools reheader', i.e. if I do
samtools reheader <in.header.sam> <in.bam>
the header in <in.bam> are replaced with the header in <in.header.sam> as
expected but somehow the alignment lines are also modified (which in my
understanding is not what you want). And then if try and index the resulting .bam
file, I do get a segmentation fault as well.
Leave a comment:
-
Any suggestion on how to find the reads that are causing the problem?
samtools view does give out the beginning of the sam file so it's not every read that's problematic, but I'm not quite sure how to locate it/them. After all the individual bam files before the merge can each be indexed without problems.
Leave a comment:
-
I just created a small BAM file from the three lines you posted, and there was no segfault on executing "samtools view -h file.bam > out.sam," with out.sam being the same as input SAM. This seems to suggest that the problem is not with FASTQ quality conversion.
I did notice that there are two optional tags concatenated in the first line: "XG:i:0AM:i:0" -- those should be separated with a tab: "XG:i:0 AM:i:0". This could cause a problem, though in my case the AM field was simply ignored in the SAM->BAM step.
Perhaps you could generate a small BAM file (suitable for email attachment) with which the segfault could be reproduced, and then post it either here or file a Samtools bug report.
Leave a comment:
-
bwa bug (?) leading to samtools segfault
Hi everyone,
In trying what might be a bit of premature optimization, I'm hitting an unfortunate segmentation fault in samtools.
This is with an illumina GAIIx. The original pipeline ungzipped the illumina fastQ files and converted them to Sanger format and then fed it to bwa and all was well.
Since bwa (0.5.9) is able to read gzipped illumina fastQ files, I decided to update the pipeline with it and then hit a segfault down the line with samtools (0.1.13) when trying to index one of the bam files (samtools index file.bam).
In looking at previous posts, I tried to see if I could go around it:
0) samtools index file.bam
This is what I'm trying to do, leading to a segfault.
1) samtools sort file.bam newfile
This works, but the resulting file still has the same issue if I try to index it. I don't know if this is relevant, but the sorted file is 58 bytes shorter (out of 8.6Gb).
2) samtools view -h file.bam > file.sam
This segfaults also, after creating a file.sam, which is truncated at 3.5Mb (8452 lines).
The last few lines are:
Code:HWI-EAS412_0004:1:53:1742:17429#0 99 1 132888 0 60M = 132919 91 GTCCCTCCCAACACTAAGGCTTTCCTAGGCAGGAGCTGGGCTGAGCCACCCGGGGGGCAG [email protected][email protected]@D>[email protected][email protected]<E5A??;< X0:i:13 X1:i:14 MD:Z:60 RG:Z:sample_tumor1 XG:i:0AM:i:0 NM:i:0 SM:i:0 XM:i:0 XO:i:0 OQ:Z:GGGGGGGGGGFGGGGGDGGBFGGGGGGGFGGGGGGBGGGFGGGGDFGBFFBGBG5DAFEF XT:A:R GA2_0011:8:71:6879:4088#0 69 1 132891 0 * = 132891 0 ACCCCGAAAGCCCAGTCAGTTTCTCTTCAGGCTCTGCCCCCCGGGTGGCTCAGCCCAGCTCCTGCCTAGGAAAGCCTTAGTGTTGGGAGGAGATCGGAAGA [email protected][email protected]:[email protected][email protected]<;9<76639855# RG:Z:sample_tumor2 OQ:Z:GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEEGFEGFEEEFFEEEEFFEEEEEEE:[email protected]@A0A?9C<AAAC4=A# GA2_0011:8:71:6879:4088#0 137 1 132891 0 92M2I7M = 132891 0 CCTCCCAACACTAAGGCTTTCCTAGGCAGGAGCTGGGCTGAGCCACCCGGGGGGCAGAGCCTGAAGAGAAACTGACTGGGCTTTCGGGGTAGATCGGAAGA :>>@[email protected]?BGGDF>AD?A?BBFEH<[email protected]<BB<58<866495675 X0:i:7 X1:i:0 MD:Z:90C1G2C3 RG:Z:sample_tumor2 XG:i:2 AM:i:0 NM:i:5 SM:i:0 XM:i:3 XO:i:1 OQ:Z:GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGFGGGGGGGGGGGGEG
This is not a big deal as I can work around this, but I'm generally of the opinion that segfaults are bad things that should be fixed. I'll be happy to provide some more information if it can help. Please tell me also if I should be posting instead on the mailing for those tools instead.
P.S. In the off-chance that this might be an issue:
The fastQ conversion was done in a simple c program, the important bit being:
Code:q33[i] = (char)((int) q33[i] - 31);
Latest Articles
Collapse
-
by seqadmin
The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i
...-
Channel: Articles
01-24-2023, 01:19 PM -
-
by seqadminSingle-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.
The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes...-
Channel: Articles
01-09-2023, 03:10 PM -
ad_right_rmr
Collapse
Leave a comment: