Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How to handle this dataset?

    Hi all,
    I have upload a txt format NGS data, after that ,under "Change Datatype" set "New Type" to interval and then click "Execute". The dataset I created like this:

    chr10 91346072 91346098 - 2119.5.1 0 ATACTAGAAAACTCTAATGTCCAAAA
    chr15 9879235 9879261 - 2119.5.2 0 AGACAAAACTCACATTCTTTCTATCA
    chr5 45627890 45627916 + 2119.5.3 1 GGGCGGCCCTGGGGATGCTCCCTCCA
    chr18 24025706 24025732 - 2119.5.4 0 CTGGTATATATTAAAAGCCACTCCTC
    This history column did not show "display at UCSC main "
    How can I get visialized in UCSC genome browser?

  • #2
    You haven't even told us what application you are talking about.

    Comment


    • #3
      I want to do Chip-seq analysis for this data.

      Comment


      • #4
        Yes, but what software are you trying to use? From the option names, my guess would be Galaxy. Are you able to display other Galaxy data on the UCSC browser, or is the problem just with this file?

        Comment


        • #5
          I can display other Galaxy data on the UCSC browser.

          Comment


          • #6
            By the way, the dataset available in http://www.ncbi.nlm.nih.gov/geo/quer...i?acc=GSE12241
            Last edited by ips; 03-21-2011, 01:39 AM.

            Comment


            • #7
              Hi,

              To view in the UCSC it should be in the bed format. See this page:


              For you data I think if you follow these steps you should be able to view it in the browser. I just tried it using the lines you provided and it worked so hope this helps.

              1. Make sure you have assigned a database to your dataset. (for example hg18 or hg19)
              2. Since the data is currently separated by spaces and you want it in tab use this tool:
              a. Under Text manipulation click Convert delimiters to TAB. (Convert all: Whitespaces)
              3. Change the datatype of your data to bed
              4. When I did this and clicked display at UCSC main it gave an error because the strand is in the wrong column.
              a. For this I used the Cut tool under Text Manipulation and cut columns (in this order) c1,c2,c3,c7,c5,c4 which correlate with chromosome, start, end, name, score, strand.
              b. I'm not sure which column is your score column so you may do this differently
              5. After these steps I clicked UCSC main view and it displayed

              I really hope this helps!

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Current Approaches to Protein Sequencing
                by seqadmin


                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                04-04-2024, 04:25 PM
              • seqadmin
                Strategies for Sequencing Challenging Samples
                by seqadmin


                Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                03-22-2024, 06:39 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 04-11-2024, 12:08 PM
              0 responses
              12 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-10-2024, 10:19 PM
              0 responses
              17 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-10-2024, 09:21 AM
              0 responses
              14 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 04-04-2024, 09:00 AM
              0 responses
              43 views
              0 likes
              Last Post seqadmin  
              Working...
              X