How to handle this dataset?

[ips]

Hi all,
I have upload a txt format NGS data, after that ,under "Change Datatype" set "New Type" to interval and then click "Execute". The dataset I created like this:

chr10 91346072 91346098 - 2119.5.1 0 ATACTAGAAAACTCTAATGTCCAAAA
chr15 9879235 9879261 - 2119.5.2 0 AGACAAAACTCACATTCTTTCTATCA
chr5 45627890 45627916 + 2119.5.3 1 GGGCGGCCCTGGGGATGCTCCCTCCA
chr18 24025706 24025732 - 2119.5.4 0 CTGGTATATATTAAAAGCCACTCCTC
This history column did not show "display at UCSC main "
How can I get visialized in UCSC genome browser？

[Simon Anders]

You haven't even told us what application you are talking about.

[ips]

I want to do Chip-seq analysis for this data.

[RDW]

Yes, but what software are you trying to use? From the option names, my guess would be Galaxy. Are you able to display other Galaxy data on the UCSC browser, or is the problem just with this file?

[ips]

I can display other Galaxy data on the UCSC browser.

[ips]

By the way, the dataset available in http://www.ncbi.nlm.nih.gov/geo/quer...i?acc=GSE12241

[nexgengirl]

Hi,

To view in the UCSC it should be in the bed format. See this page:

http://genome.ucsc.edu/FAQ/FAQformat.html#format1

For you data I think if you follow these steps you should be able to view it in the browser. I just tried it using the lines you provided and it worked so hope this helps.

1. Make sure you have assigned a database to your dataset. (for example hg18 or hg19)
2. Since the data is currently separated by spaces and you want it in tab use this tool:
a. Under Text manipulation click Convert delimiters to TAB. (Convert all: Whitespaces)
3. Change the datatype of your data to bed
4. When I did this and clicked display at UCSC main it gave an error because the strand is in the wrong column.
a. For this I used the Cut tool under Text Manipulation and cut columns (in this order) c1,c2,c3,c7,c5,c4 which correlate with chromosome, start, end, name, score, strand.
b. I'm not sure which column is your score column so you may do this differently
5. After these steps I clicked UCSC main view and it displayed

I really hope this helps!