Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • ips
    Member
    • Jan 2011
    • 11

    #1

    How to handle this dataset?

    Hi all,
    I have upload a txt format NGS data, after that ,under "Change Datatype" set "New Type" to interval and then click "Execute". The dataset I created like this:

    chr10 91346072 91346098 - 2119.5.1 0 ATACTAGAAAACTCTAATGTCCAAAA
    chr15 9879235 9879261 - 2119.5.2 0 AGACAAAACTCACATTCTTTCTATCA
    chr5 45627890 45627916 + 2119.5.3 1 GGGCGGCCCTGGGGATGCTCCCTCCA
    chr18 24025706 24025732 - 2119.5.4 0 CTGGTATATATTAAAAGCCACTCCTC
    This history column did not show "display at UCSC main "
    How can I get visialized in UCSC genome browser?
  • Simon Anders
    Senior Member
    • Feb 2010
    • 995

    #2
    You haven't even told us what application you are talking about.

    Comment

    • ips
      Member
      • Jan 2011
      • 11

      #3
      I want to do Chip-seq analysis for this data.

      Comment

      • RDW
        Member
        • Oct 2008
        • 63

        #4
        Yes, but what software are you trying to use? From the option names, my guess would be Galaxy. Are you able to display other Galaxy data on the UCSC browser, or is the problem just with this file?

        Comment

        • ips
          Member
          • Jan 2011
          • 11

          #5
          I can display other Galaxy data on the UCSC browser.

          Comment

          • ips
            Member
            • Jan 2011
            • 11

            #6
            By the way, the dataset available in http://www.ncbi.nlm.nih.gov/geo/quer...i?acc=GSE12241
            Last edited by ips; 03-21-2011, 01:39 AM.

            Comment

            • nexgengirl
              Member
              • Apr 2010
              • 31

              #7
              Hi,

              To view in the UCSC it should be in the bed format. See this page:


              For you data I think if you follow these steps you should be able to view it in the browser. I just tried it using the lines you provided and it worked so hope this helps.

              1. Make sure you have assigned a database to your dataset. (for example hg18 or hg19)
              2. Since the data is currently separated by spaces and you want it in tab use this tool:
              a. Under Text manipulation click Convert delimiters to TAB. (Convert all: Whitespaces)
              3. Change the datatype of your data to bed
              4. When I did this and clicked display at UCSC main it gave an error because the strand is in the wrong column.
              a. For this I used the Cut tool under Text Manipulation and cut columns (in this order) c1,c2,c3,c7,c5,c4 which correlate with chromosome, start, end, name, score, strand.
              b. I'm not sure which column is your score column so you may do this differently
              5. After these steps I clicked UCSC main view and it displayed

              I really hope this helps!

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 08-03-2026, 10:13 AM
              0 responses
              17 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-31-2026, 02:55 AM
              0 responses
              33 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              23 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-23-2026, 11:41 AM
              0 responses
              21 views
              0 reactions
              Last Post SEQadmin2  
              Working...