RNASeq - overrepresent sequences

JoaoMoura

Junior Member

Join Date: Mar 2011

Posts: 2
- Share
- Tweet
#1

RNASeq - overrepresent sequences

03-28-2011, 08:41 AM

Hey guys!

First of all, I'm sorry If I'm puting this question in the wrong section, but I'm new to this forum.

Well, I'm doing DE with RNASeq and after doing some QA and QC (removed the solexa adapter and trimmed the reads) I still have an 2 overrepresented sequences from most of my fasta files, which are:

CGATGAAGAACGCAGCGAAATG

CCCCCTGGAATACCAAGGGGCG

Do you have any idea what they are?

Thanks a lot!
Tags: None
maubp

Peter (Biopython etc)

Join Date: Jul 2009

Posts: 1544
- Share
- Tweet
#2

03-28-2011, 10:19 AM

Were any PCR primers used in preparing the sample?
Comment
JoaoMoura

Junior Member

Join Date: Mar 2011

Posts: 2
- Share
- Tweet
#3

03-28-2011, 10:58 AM

Hi!

Actually I'm not sure. But background is not biological, but I tried looking in the article and suplementary material, but I didn't find anything.

This is the article:

PLOS Genetics

http://www.plosgenetics.org/article/info%3Adoi%2F10.1371%2Fjournal.pgen.1000299#s5
Comment

Previous template Next

Nine Things a Sample Prep Scientist Thinks About Before Sequencing

by SEQadmin2

I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

Here are nine questions we think about, in roughly the order they matter, before...
- Channel: Articles
06-18-2026, 07:11 AM
From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data

by SEQadmin2

Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...
- Channel: Articles
06-02-2026, 10:05 AM
Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends

by SEQadmin2

With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.

Introduction

Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
- Channel: Articles
05-22-2026, 06:42 AM

Topics	Statistics	Last Post
Whole-Genome Sequencing Traces Faroe Islands Ancestry to a North Atlantic Founder Population by SEQadmin2 Started by SEQadmin2, 06-17-2026, 06:09 AM	0 responses 24 views 0 reactions	Last Post by SEQadmin2 06-17-2026, 06:09 AM
Sequencing the Two-Toed Sloth Genome Reveals Jumping Genes Tied to Its Extreme Metabolism by SEQadmin2 Started by SEQadmin2, 06-09-2026, 11:58 AM	0 responses 40 views 0 reactions	Last Post by SEQadmin2 06-09-2026, 11:58 AM
A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2 Started by SEQadmin2, 06-05-2026, 10:09 AM	0 responses 47 views 0 reactions	Last Post by SEQadmin2 06-05-2026, 10:09 AM
A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2 Started by SEQadmin2, 06-04-2026, 08:59 AM	0 responses 49 views 0 reactions	Last Post by SEQadmin2 06-04-2026, 08:59 AM

Unconfigured Ad

RNASeq - overrepresent sequences

Comment

Comment

Latest Articles

ad_right_rmr

News