snpeff effect prediction confusion

SEQanswers June Challenge Has Begun!

The competition has begun! We're giving away a $50 Amazon gift card to the member who answers the most questions on our site during the month. We want to encourage our community members to share their knowledge and help each other out by answering questions related to sequencing technologies, genomics, and bioinformatics. The competition is open to all members of the site, and the winner will be announced at the beginning of July. Best of luck!

For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)

See less

najoshi

Member

Join Date: Feb 2010
Posts: 19

snpeff effect prediction confusion

07-07-2021, 03:01 AM

So I am trying to figure out why this particular complex variant was annotated with an effect of "start_lost" when I don't see any evidence of the start codon being changed. Here is the full vcf line:

Code:

chr1	20717668	.	ACGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAA	GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC	566.598	.	AB=0.347826;ABP=12.2627;AC=5;AF=0.5;AN=10;AO=16;CIGAR=1X57M1X;DP=46;DPB=46.1525;DPRA=0;EPP=5.18177;EPPR=4.16842;GTI=0;LEN=59;MEANALT=1;MQM=60;MQMR=60;NS=5;NUMALT=1;ODDS=5.38955;PAIRED=0.5625;PAIREDR=0.466667;PAO=9;PQA=333;PQR=0;PRO=0;QA=586;QR=1103;RO=30;RPL=13;RPP=16.582;RPPR=31.9633;RPR=3;RUN=1;SAF=7;SAP=3.55317;SAR=9;SRF=8;SRP=17.1973;SRR=22;TYPE=complex;ANN=GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3958|1/3087|1/1028||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001287212.2|protein_coding|1/15|c.-447_-389delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2098|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103161.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541459.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541460.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541462.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541461.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103160.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|intron_variant|MODIFIER|LOC107985528|LOC107985528|transcript|unknown_transcript_1|protein_coding|987/1510|c.167449+904178_167449+904236delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||WARNING_TRANSCRIPT_MULTIPLE_STOP_CODONS;LOF=(KIF17|KIF17|3|0.67)	GT:DP:AD:RO:QR:AO:QA:GL	0/1:4:3,1:3:111:1:37:-2.49371,0,-9.14896	0/1:9:6,3:6:221:3:109:-13.5154,0,-16.9355	0/1:11:6,5:6:223:5:182:-16.4518,0,-16.8162	0/1:12:8,4:8:294:4:149:-22.2684,0,-21.995	0/1:10:7,3:7:254:3:109:-13.2144,0,-19.5986

The first annotation looks like this:

Code:

GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||

For some reason it is calling it a deletion & insertion instead of just two separate SNPs. Looking at the two sequences:

Code:

TTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGT
GTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC

you can see that all of the bases are the same except for the first and last bases. The start codon is in the middle, i.e. this variant crosses the 5'UTR to exon 1 boundary. However, the start codon does not change, so why is it being annotated as a "start_lost"?

Tags: hgvs, snpeff, variant annotation

Previous template Next

A Review of Next-Generation Sequencing Methods for Studying Epigenetics—Part 1

by seqadmin

Developments in sequencing technologies and methodologies have transformed the field of epigenetics, giving researchers a better way to understand the complex world of gene regulation and heritable modifications. This article explores some of the diverse sequencing methods employed in the study of epigenetics, ranging from classic techniques to cutting-edge innovations while providing a brief overview of their processes, applications, and advances.

Methylation Detect...
- Channel: Articles
05-31-2023, 10:46 AM
Differential Expression and Data Visualization: Recommended Tools for Next-Level Sequencing Analysis

by seqadmin

After covering QC and alignment tools in the first segment and variant analysis and genome assembly in the second segment, we’re wrapping up with a discussion about tools for differential gene expression analysis and data visualization. In this article, we include recommendations from the following experts: Dr. Mark Ziemann, Senior Lecturer in Biotechnology and Bioinformatics, Deakin University; Dr. Medhat Mahmoud Postdoctoral Research Fellow at Baylor College of Medicine;...
- Channel: Articles
05-23-2023, 12:26 PM
Variant Analysis and Genome Assembly: Recommended Tools for Next-Level Sequencing Analysis

by seqadmin

Continuing from our previous article, we share variant analysis and genome assembly tools recommended by our experts Dr. Medhat Mahmoud, Postdoctoral Research Fellow at Baylor College of Medicine, and Dr. Ming "Tommy" Tang, Director of Computational Biology at Immunitas and author of From Cell Line to Command Line.

Variant detection and analysis tools
Mahmoud classifies variant detection work into two main groups: short variants (<50...
- Channel: Articles
05-19-2023, 10:03 AM

Topics	Statistics	Last Post
Analysis of West Nile Virus Explores Transmission Dynamics in Animal Species by seqadmin Started by seqadmin, 06-07-2023, 07:14 AM	0 responses 11 views 0 likes	Last Post by seqadmin 06-07-2023, 07:14 AM
BabySeq Project: Unveiling Medically Actionable Variants by seqadmin Started by seqadmin, 06-06-2023, 01:08 PM	0 responses 11 views 0 likes	Last Post by seqadmin 06-06-2023, 01:08 PM
Genetic Discoveries Transform Our Understanding of Primate Diversity and Behavior by seqadmin Started by seqadmin, 06-01-2023, 08:56 PM	0 responses 164 views 0 likes	Last Post by seqadmin 06-01-2023, 08:56 PM
Deep Sequencing Unearths Novel Genetic Variants: Enhancing Precision Medicine for Vascular Anomalies by seqadmin Started by seqadmin, 06-01-2023, 07:33 AM	0 responses 299 views 0 likes	Last Post by seqadmin 06-01-2023, 07:33 AM

Header Leaderboard Ad

snpeff effect prediction confusion

Announcement

SEQanswers June Challenge Has Begun!

snpeff effect prediction confusion

Latest Articles

ad_right_rmr

News