Seqanswers Leaderboard Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    Predicting true SNPs from .vcf file

    The .vcf file contains so many different measurements, and a couple of different quality scores, does anyone have a good empirical idea of which values are the best guidelines to picking out real SNPs from noise and artifacts? I've done about a hundred sanger sequencing reactions on a variety of predicted SNPs at a variety of quality levels, but the picture still isn't very clear.

    For instance these SNPs looked real in the sanger:

    GT:PL:GQ 0/1:20,11,149:13 gcacacacacacacacacacacacacacacacacacacacac gcacacacacacacacacacacacacacacacacacacac 211 DP=95 DP4=17,0,10,2 MQ=48 FQ=214

    GT:PL:GQ 1/1:30,3,0:39 GAA GA 147 DP=10 DP4=0,0,1,6 MQ=48 FQ=-37.3


    These did not confirm with sanger sequencing

    GT:PL:GQ 0/1:24,0,114:27 A C 110 DP=130 DP4=14,35,2,22 MQ=45 FQ=113

    GT:PL:GQ 0/1:40,0,47:42 T G 98.3 DP=71 DP4=17,1,14,0 MQ=44 FQ=101

    Those don't look notably worse than the ones above them, so I'm not sure what I should have looked at to predict that the bottom two were false positives.

    (My a priori assumption was that these variants were all real, because I made a multi-vcf with mpileup with this samples and many sibling animals, and these variants were common to all the animals)
  • elisadouzi
    Member
    • Mar 2011
    • 20

    #2
    maybe the depth of the bottom two is too high. Have you try the -D options?

    Originally posted by swbarnes2 View Post
    The .vcf file contains so many different measurements, and a couple of different quality scores, does anyone have a good empirical idea of which values are the best guidelines to picking out real SNPs from noise and artifacts? I've done about a hundred sanger sequencing reactions on a variety of predicted SNPs at a variety of quality levels, but the picture still isn't very clear.

    For instance these SNPs looked real in the sanger:

    GT:PL:GQ 0/1:20,11,149:13 gcacacacacacacacacacacacacacacacacacacacac gcacacacacacacacacacacacacacacacacacacac 211 DP=95 DP4=17,0,10,2 MQ=48 FQ=214

    GT:PL:GQ 1/1:30,3,0:39 GAA GA 147 DP=10 DP4=0,0,1,6 MQ=48 FQ=-37.3


    These did not confirm with sanger sequencing

    GT:PL:GQ 0/1:24,0,114:27 A C 110 DP=130 DP4=14,35,2,22 MQ=45 FQ=113

    GT:PL:GQ 0/1:40,0,47:42 T G 98.3 DP=71 DP4=17,1,14,0 MQ=44 FQ=101

    Those don't look notably worse than the ones above them, so I'm not sure what I should have looked at to predict that the bottom two were false positives.

    (My a priori assumption was that these variants were all real, because I made a multi-vcf with mpileup with this samples and many sibling animals, and these variants were common to all the animals)

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Pathogen Surveillance with Advanced Genomic Tools
      by seqadmin




      The COVID-19 pandemic highlighted the need for proactive pathogen surveillance systems. As ongoing threats like avian influenza and newly emerging infections continue to pose risks, researchers are working to improve how quickly and accurately pathogens can be identified and tracked. In a recent SEQanswers webinar, two experts discussed how next-generation sequencing (NGS) and machine learning are shaping efforts to monitor viral variation and trace the origins of infectious...
      03-24-2025, 11:48 AM
    • seqadmin
      New Genomics Tools and Methods Shared at AGBT 2025
      by seqadmin


      This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

      The Headliner
      The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
      03-03-2025, 01:39 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Today, 10:17 AM
    0 responses
    7 views
    0 reactions
    Last Post seqadmin  
    Started by seqadmin, 03-20-2025, 05:03 AM
    0 responses
    49 views
    0 reactions
    Last Post seqadmin  
    Started by seqadmin, 03-19-2025, 07:27 AM
    0 responses
    59 views
    0 reactions
    Last Post seqadmin  
    Started by seqadmin, 03-18-2025, 12:50 PM
    0 responses
    50 views
    0 reactions
    Last Post seqadmin  
    Working...