Tweet
The .vcf file contains so many different measurements, and a couple of different quality scores, does anyone have a good empirical idea of which values are the best guidelines to picking out real SNPs from noise and artifacts? I've done about a hundred sanger sequencing reactions on a variety of predicted SNPs at a variety of quality levels, but the picture still isn't very clear.
For instance these SNPs looked real in the sanger:
GT:PL:GQ 0/1:20,11,149:13 gcacacacacacacacacacacacacacacacacacacacac gcacacacacacacacacacacacacacacacacacacac 211 DP=95 DP4=17,0,10,2 MQ=48 FQ=214
GT:PL:GQ 1/1:30,3,0:39 GAA GA 147 DP=10 DP4=0,0,1,6 MQ=48 FQ=-37.3
These did not confirm with sanger sequencing
GT:PL:GQ 0/1:24,0,114:27 A C 110 DP=130 DP4=14,35,2,22 MQ=45 FQ=113
GT:PL:GQ 0/1:40,0,47:42 T G 98.3 DP=71 DP4=17,1,14,0 MQ=44 FQ=101
Those don't look notably worse than the ones above them, so I'm not sure what I should have looked at to predict that the bottom two were false positives.
(My a priori assumption was that these variants were all real, because I made a multi-vcf with mpileup with this samples and many sibling animals, and these variants were common to all the animals)
For instance these SNPs looked real in the sanger:
GT:PL:GQ 0/1:20,11,149:13 gcacacacacacacacacacacacacacacacacacacacac gcacacacacacacacacacacacacacacacacacacac 211 DP=95 DP4=17,0,10,2 MQ=48 FQ=214
GT:PL:GQ 1/1:30,3,0:39 GAA GA 147 DP=10 DP4=0,0,1,6 MQ=48 FQ=-37.3
These did not confirm with sanger sequencing
GT:PL:GQ 0/1:24,0,114:27 A C 110 DP=130 DP4=14,35,2,22 MQ=45 FQ=113
GT:PL:GQ 0/1:40,0,47:42 T G 98.3 DP=71 DP4=17,1,14,0 MQ=44 FQ=101
Those don't look notably worse than the ones above them, so I'm not sure what I should have looked at to predict that the bottom two were false positives.
(My a priori assumption was that these variants were all real, because I made a multi-vcf with mpileup with this samples and many sibling animals, and these variants were common to all the animals)
Comment