Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • burt
    Junior Member
    • Jan 2011
    • 8

    #1

    Error in bowtie's sam output?

    Hi,

    I'm not sure if its a bug with the bowtie's sam output, but all my mapping quality would take the value of 255 while the bit flag would take on values of either 0,4,16. I had run bowtie in colorspace.

    Has anyone else encountered a similar issue?

    Here's a sample of the sam output with the qwerky values.

    1279_33_430_F3 4 * 0 0 * * 0 0 TGGTGACCTGGGCCCTGAGGANCGCGTTGATCTACCTCCGCTCAATTGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XM:i:0
    1279_33_409_F3 16 chr6 49186545 255 50M * 0 0 TATTCGTACTGAAAATCAAGATCAAGCGAGCTTTTGCCCTTCTGCTCCAC Iqqqqqqqqqqqqqqqqqqqqqqqqqq!Iq!!qqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:50 NM:i:0 CM:i:2
    1279_34_783_F3 0 chr16 11144009 255 50M * 0 0 TATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGGATT Iqqqqqqqqqqqqqqqqqqqq!Iqqqqqqqqqqqqqqqqqqqqqqq!!qI XA:i:2 MD:Z:50 NM:i:0 CM:i:2
    1279_40_121_F3 0 chr17 39983712 255 50M * 0 0 ACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACC Iqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq!!qqq!!qqqqI XA:i:2 MD:Z:50 NM:i:0 CM:i:2
    1279_41_567_F3 16 chr6 49186546 255 50M * 0 0 ATTCGTACTGAAAATCAAGATCAAGCGAGCTTTTGCCCTTCTGCTCCACG IqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqI XA:i:0 MD:Z:50 NM:i:0 CM:i:0


    -burt
  • me_myself_andI
    Member
    • Nov 2010
    • 30

    #2
    Related and up to now also unanswered post: http://seqanswers.com/forums/showthread.php?t=10624

    Comment

    • Joker!sAce
      Member
      • Feb 2011
      • 21

      #3
      Field MAPQ considers pairing in calculation if the read is paired. If such a calculation is difficult, 255 is applied, indicating the mapping quality is not available. I assume your query sequences had quality scores with them(FastQ files). Maybe your query sequence was not paired? There is a high order of probability that this is not an error and you should not worry about it, but confirm this.
      Last edited by Joker!sAce; 04-11-2011, 03:45 AM.

      Comment

      • burt
        Junior Member
        • Jan 2011
        • 8

        #4
        Hi, thanks for the reply. My input data is a set of single-end reads. I'm pretty sure if a problem with the sam output in colorspace.

        Just something to add on to the problem description. If I were to look only are reads that are mappable, all of them are reported to have 50M perfect matching. This is very unusual as it's highly unlikely for all reads to map perfectly to the reference genome, especially when we are investigating the transcriptome landscape of the cell.

        Comment

        • feixue1039
          Member
          • Mar 2011
          • 18

          #5
          Hi

          I encountered the same issue as burt. My input data is single-end reads sequenced by Illumina Hiseq 2000 platform. I just wonder whether a read with a MAPQ value of 255 is filtered or not before the calculation of FPKM value in downstream analyses (for instance, cufflinks/cuffdiff)?

          Any reply will be appreciated.

          feixue1039

          Comment

          • swbarnes2
            Senior Member
            • May 2008
            • 910

            #6
            Originally posted by burt View Post
            If I were to look only are reads that are mappable, all of them are reported to have 50M perfect matching.
            That's not what the CIGAR score means. 50M only means no indels, no hard or soft clipping at the ends. There are other elements later in the sam line that indicate what the discrepancies exist between the read and the reference.

            Comment

            • loodramon
              Junior Member
              • Feb 2012
              • 2

              #7
              Hi,

              I am seeing the same thing with my single stranded (non-paired) RNA-seq alignments.

              There is either a Mapping Quality score of 255 and has a bit flag of 16 or else the read is not mapped and has a bit flag of 4.

              Is this common to all non-paired RNA-seq data? I'm new to RNA-seq.

              Thanks in advance

              Comment

              • loodramon
                Junior Member
                • Feb 2012
                • 2

                #8
                Hi again,

                I should mention that I used the latest version of bowtie for this alignment.

                I've been told by a colleague that: Bowtie doesn't calculate mapping quality values, so it prints 255 to the MAPQ field of the sam file if the read aligns or 0 otherwise.

                Comment

                • edge
                  Senior Member
                  • Sep 2009
                  • 199

                  #9
                  Hi,

                  Do you know what is the meaning of 100M from bowtie sam output?
                  I run bowtie with single-read.
                  My input file is 100 read length.

                  Thanks.

                  Comment

                  • edge
                    Senior Member
                    • Sep 2009
                    • 199

                    #10
                    Hi.

                    Thanks for answer about 255 by bowtie sam output.

                    Hi,

                    Do you know what is the meaning of 100M from bowtie sam output?
                    I run bowtie with single-read.
                    My input file is 100 read length.

                    Thanks.

                    Comment

                    • dpryan
                      Devon Ryan
                      • Jul 2011
                      • 3478

                      #11
                      Originally posted by edge View Post
                      Hi,

                      Do you know what is the meaning of 100M from bowtie sam output?
                      I run bowtie with single-read.
                      My input file is 100 read length.

                      Thanks.
                      It's generally better to start a new thread rather than to resurrect a really old one. Nevertheless, the "100M" is part of the CIGAR string, which is defined in the SAM specification. It means 100 matches (practically, this just means that there were no indels). I recommend familiarising yourself with the SAM format if you're going to do much with sequencing data.

                      Comment

                      • edge
                        Senior Member
                        • Sep 2009
                        • 199

                        #12
                        Thanks, dpryan.

                        I will have a look on the document that you shared.
                        Really appreciate

                        Comment

                        Latest Articles

                        Collapse

                        • SEQadmin2
                          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                          by SEQadmin2



                          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                          Despite this, “CRISPR helped turn genome editing from a specialized technique into
                          ...
                          07-31-2026, 11:01 AM
                        • SEQadmin2
                          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                          by SEQadmin2


                          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                          The systematic characterization of the human proteome has
                          ...
                          07-20-2026, 11:48 AM
                        • SEQadmin2
                          Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                          by SEQadmin2



                          Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                          ...
                          07-09-2026, 11:10 AM

                        ad_right_rmr

                        Collapse

                        News

                        Collapse

                        Topics Statistics Last Post
                        Started by SEQadmin2, 08-03-2026, 10:13 AM
                        0 responses
                        17 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 07-31-2026, 02:55 AM
                        0 responses
                        33 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 07-24-2026, 12:17 PM
                        0 responses
                        23 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 07-23-2026, 11:41 AM
                        0 responses
                        21 views
                        0 reactions
                        Last Post SEQadmin2  
                        Working...