split a fastq file

[lfaino]

Dear All,
I need to split a fastq file in two files in which there is one pair in one and the other pair in the other. It looks that CLC needs to files to select pair ends reads. the file now looks like this:

>ILLUMINA-52179E_0050_FC70G0HAAXX:6:1:2997:934#GCCAAT/1
TACCACCCAGGCCCCGTCTATCTATATCATCACTCGATTTATTATCCTCTAGTAATCCTCCCGAAATCCCTGAA
>ILLUMINA-52179E_0050_FC70G0HAAXX:6:1:2997:934#GCCAAT/1
quality line
>ILLUMINA-52179E_0050_FC70G0HAAXX:6:1:2997:934#GCCAAT/2
TCCTGAGTCAATTGCAGAGCAGTTTCATTTCTATGAGCATGATTCTTCGGCATAAAAGTCGAGCATGAACTATGT
>ILLUMINA-52179E_0050_FC70G0HAAXX:6:1:2997:934#GCCAAT/2
quality line

thanks in advance
Luigi

[Kennels]

Galaxy has a tool which does this.
Visit: http://main.g2.bx.psu.edu/

On the left hand pane, go to:
NGS: QC and manipulation
Fastq splitter

and follow instructions.

[lfaino]

Hi Kennels,
it is not what I want. I have already the sequence dividend in forw and rev. I need to divide them in a file containing the /1 and in a file the /2. that`s it

Luigi

[swbarnes2]

What's wrong with grep? Or some scripting language?

While you are at it, use sed to get rid of the text following the +, since it's just pointlessly making your file larger.

[Kennels]

Hi Luigi,

Unless I'm understanding you wrongly, you want to split a paired end fastq file into two files, one containing read 1, and the other read 2, correct?

Well, that's the tool I described in Galaxy:

From the page:
*****************************
What it does

Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have the same length.

Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively.
****************************************