Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • dariober
    Senior Member
    • May 2010
    • 311

    How does "mpileup -Q" option work?

    Hi All,

    samtools mpileup has a -Q option which "skip bases with baseQ/BAQ smaller than INT [13]". My understanding is that bases with phred quality (11th column in SAM) less than Q are not counted in the resulting pileup, right?

    However, it seems to me that -Q has no effect. Here's an example using the toy.sam file in the example dir that comes with samtools:
    Code:
    ## Convert SAM to BAM
    samtools view -b -S /.../samtools-0.1.15/examples/toy.sam > toy.bam
    samtools view toy.bam
    r001    163     ref     7       30      8M4I4M1D3M      =       37      39      TTAGATAAAGAGGATACTG     *
    r002    0       ref     9       30      1S2I6M1P1I1P1I4M2I      *       0       0       AAAAGATAAGGGATAAA       *
    r003    0       ref     9       30      5H6M    *       0       0       AGCTAA  *
    r004    0       ref     16      30      6M14N1I5M       *       0       0       ATAGCTCTCAGC    *
    r003    16      ref     29      30      6H5M    *       0       0       TAGGC   *
    r001    83      ref     37      30      9M      =       7       -39     CAGCGCCAT       *
    x1      0       ref2    1       30      20M     *       0       0       AGGTTTTATAAAACAAATAA    ????????????????????
    x2      0       ref2    2       30      21M     *       0       0       GGTTTTATAAAACAAATAATT   ?????????????????????
    x3      0       ref2    6       30      9M4I13M *       0       0       TTATAAAACAAATAATTAAGTCTACA      ??????????????????????????
    x4      0       ref2    10      30      25M     *       0       0       CAAATAATTAAGTCTACAGAGCAAC       ?????????????????????????
    x5      0       ref2    12      30      24M     *       0       0       AATAATTAAGTCTACAGAGCAACT        ????????????????????????
    x6      0       ref2    14      30      23M     *       0       0       TAATTAAGTCTACAGAGCAACTA ???????????????????????
    
    
    ## Produce pileup:
    samtools mpileup toy.bam > toy.mpileup
    
    ## Produce pileup with ridiculously high -Q:
    samtools mpileup -Q 100 toy.bam > toyQ.mpileup
    
    ## -Q has no effect!
    wc toy.mpileup toyQ.mpileup
    75  450 1473 toy.mpileup
    75  450 1473 toyQ.mpileup
    150  900 2946 total
    I'm using samtools 0.1.15. Am I missing something obvious here?

    All the best

    Dario
  • ramensky
    Junior Member
    • May 2010
    • 1

    #2
    Hi, I had the same confusion, too. My experience is that -Q affects the output only in the BCF output mode (invoked with -u or -g), but not in the pileup mode, as in your example. In the meantime, -q (min read mapping quality) applies to both output modes.

    Hope this helps.
    Last edited by ramensky; 02-02-2012, 04:43 PM.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    14 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    31 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    42 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    27 views
    0 reactions
    Last Post SEQadmin2  
    Working...