Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • nturay
    Junior Member
    • Jun 2010
    • 2

    A samtools v0.1.11 bug???

    Hi all,

    I've extracted one paired-end read from BWA aligned result and use samtools v0.1.11 to convert them to a BAM file as my test data set as below :

    HWUSI-EAS1812:1:23:18626:4628#0 99 chr1 10542 10 76M = 10817 314 CGAAATCTGGGCAGAGGAGAACGCAGCTCCGCCCTCGCGGGGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCC ############################################################################ XT:A:U NM:i:3 SM:i:10 AM:i:10 X0:i:1 X1:i:3 XM:i:3 XO:i:0 XG:i:0 MD:Z:9T8C21T35 XA:Z:chr15,-102520467,76M,4;chr12,-95006,76M,4;chr16,+60483,76M,4;

    HWUSI-EAS1812:1:23:18626:4628#0 147 chr1 10817 10 6S24M2D7M1D5M34S = 10542 -314 TCCAGGGGGGTGGAGGCGTGGCGCAGGCGCAGAGGCGGCCGCCTCCGGGTGGGGGTTGGTGGGGCGTGTGGTGCAG ###################################################@14@9-700014>+1B7BB:4??-? XT:A:M NM:i:3 SM:i:10 AM:i:10 XM:i:0 XO:i:2 XG:i:3 MD:Z:24^AG7^C5


    Then I use Bio-SamTools v 1.27 to grab the chr, start, end, strand information from this BAM file.

    The result gives as below :

    chr1 10542 10617 1
    chr1 10817 10855 -1


    chr1 10817 10855 -1
    chr1 10542 10568 1


    The first one (Blue) seems to be the correct answer, but its mate pair gives different ending position.

    I am wondering whether it's a samtools 0.1.11 (r851) bug or so?

    Ray
    Last edited by nturay; 04-28-2011, 02:54 AM.

Latest Articles

Collapse

  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    Yesterday, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM
  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Today, 10:04 AM
0 responses
6 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, Yesterday, 10:08 AM
0 responses
6 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-02-2026, 11:08 AM
0 responses
31 views
0 reactions
Last Post SEQadmin2  
Working...