Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • nturay
    Junior Member
    • Jun 2010
    • 2

    #1

    A samtools v0.1.11 bug???

    Hi all,

    I've extracted one paired-end read from BWA aligned result and use samtools v0.1.11 to convert them to a BAM file as my test data set as below :

    HWUSI-EAS1812:1:23:18626:4628#0 99 chr1 10542 10 76M = 10817 314 CGAAATCTGGGCAGAGGAGAACGCAGCTCCGCCCTCGCGGGGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCC ############################################################################ XT:A:U NM:i:3 SM:i:10 AM:i:10 X0:i:1 X1:i:3 XM:i:3 XO:i:0 XG:i:0 MD:Z:9T8C21T35 XA:Z:chr15,-102520467,76M,4;chr12,-95006,76M,4;chr16,+60483,76M,4;

    HWUSI-EAS1812:1:23:18626:4628#0 147 chr1 10817 10 6S24M2D7M1D5M34S = 10542 -314 TCCAGGGGGGTGGAGGCGTGGCGCAGGCGCAGAGGCGGCCGCCTCCGGGTGGGGGTTGGTGGGGCGTGTGGTGCAG ###################################################@14@9-700014>+1B7BB:4??-? XT:A:M NM:i:3 SM:i:10 AM:i:10 XM:i:0 XO:i:2 XG:i:3 MD:Z:24^AG7^C5


    Then I use Bio-SamTools v 1.27 to grab the chr, start, end, strand information from this BAM file.

    The result gives as below :

    chr1 10542 10617 1
    chr1 10817 10855 -1


    chr1 10817 10855 -1
    chr1 10542 10568 1


    The first one (Blue) seems to be the correct answer, but its mate pair gives different ending position.

    I am wondering whether it's a samtools 0.1.11 (r851) bug or so?

    Ray
    Last edited by nturay; 04-28-2011, 02:54 AM.

Latest Articles

Collapse

  • SEQadmin2
    New Genomics Technologies Take Aim at Long-Standing Limits
    by SEQadmin2


    Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

    We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
    ...
    Today, 10:25 AM
  • SEQadmin2
    How Immunogenomics Decodes Immunity’s Genetic Blueprint
    by SEQadmin2




    The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

    This convergence of genetics, immunology, and computation...
    09-01-2026, 05:41 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 09-25-2026, 09:06 AM
0 responses
28 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-23-2026, 11:05 AM
0 responses
24 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-18-2026, 11:37 AM
1 response
46 views
0 reactions
Last Post pekgio
by pekgio
 
Started by SEQadmin2, 09-16-2026, 10:23 AM
1 response
55 views
0 reactions
Last Post pekgio
by pekgio
 
Working...