Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    Originally posted by rufessor View Post
    I may be answering in part my question- or at least clarifying my question.
    I am no longer certain that the sleeping process list actually really effectively did anything to the cache- its almost always used to capacity by linux so I guess my question is-

    what the heck are those 40 + sleeping processes doing- and are they effectively actually consuming any resource whatsoever. Do they really hold ram or is it just cached...

    Would be curious.
    Most modern linux distros manage memory internally so one can't depend on output of htop/top alone. With a TB of RAM you should have no worries about memory consumption

    See: http://www.linuxatemyram.com/

    Comment

    • travelk
      Member
      • Jul 2013
      • 20

      Hey everyone,

      I've used trimmomatic to clean up my reads but when I use the cleaned files in tophat, I get an error. When I examined a bit closer I discovered that trimmomatic converted this:

      @D3VDZHS1:119:H036PADXX:1:1202:12533:34018 2:N:0:GGACTCCTTAGATCGC
      ATAGACAAATGCCTGCAACAACGCAGGGATCTCTTTCCCGGTAAACCAACCGTCGTCATTGAAGATATGCATGCTGGCTCGGGTATCCCATTGCTGATAC
      +
      @@CADDFFBBFHHJIGIJJIIJIBDDGE@ABGEHGGGIJIGF:CFFHGIJG<?8ADBDB@AC;.;>A>>@>:@ACC@@?C<BB(0>(:@(4::@(+4>A>
      @D3VDZHS1:119:H036PADXX:1:1202:12611:34155 2:N:0:GGACTCCTTAGATCGC
      GGTATCAACGCAGAGTACTTTTTTTTTTTCTTTTTTTTTTTTTTTTTTAAAGGAAAACCAGACAAATCATGAAGCCACATACGCTAGAGAAGCTCAATAC
      +
      B@@DFFDFHHGHHGIEHHIJIIJJJJJJI)BFGG):BCDDDDDDDDB#####################################################
      @D3VDZHS1:119:H036PADXX:1:1202:12731:34205 2:N:0:GGACTCCTTAGATCGC
      TAATAAATCCGCTACCGACGCTGACTAACATTTCGCGATCGTTCATCGCATCACCAAAGGCCGTGCAATCGCGCAACGATAAACCTAAATGTTGGGTCAG
      +
      @@CFFFFFHHHHHIJJIIJIIIJJJGIIJJJJJIIJJBAHG@GHEHFGF=BCEEEC?AC?AAB8888@CC??>BBDD>BBBBCDDAACDCDDC@8<?CBC


      TO:

      @D3VDZHS1:119:H036PADXX:1:1202:12533:34018 2:N:0:GGACTCCTTAGATCGC
      ATAGACAAATGCCTGCAACAACGCAGGGATCTCTTTCCCGGTAAACCAACCGTCGTCATTGAAGATATGCATGCTGGCTCGGGTAT+
      @@CADDFFBBFHHJIGIJJIIJIBDDGE@ABGEHGGGIJIGF:CFFHGIJG<?8ADBDB@AC;.;>A>>@>:@ACC@@?C<BB(0>
      @D3VDZHS1:119:H036PADXX:1:1202:12731:34205 2:N:0:GGACTCCTTAGATCGC
      TAATAAATCCGCTACCGACGCTGACTAACATTTCGCGATCGTTCATCGCATCACCAAAGGCCGTGCAATCGCGCAACGATAAACCTAAATGTTGGGTCAG
      +
      @@CFFFFFHHHHHIJJIIJIIIJJJGIIJJJJJIIJJBAHG@GHEHFGF=BCEEEC?AC?AAB8888@CC??>BBDD>BBBBCDDAACDCDDC@8<?CBC

      Obviously trimmomatic didn't put + on the next line and now tophat can't read the line properly. This has happened in multiple files. Does anyone know if a) this is normal for trimmomatic and I need to fix this manually or if b) I did something wrong to cause it?

      My input code:

      Code:
      java -jar /path/to/Trimmomatic-0.32/trimmomatic-0.32.jar PE -threads 8 -phred33 -trimlog Sample1trimlog sample1_R1.fastq sample1_R2.fastq sample1_R1_TP.fastq sample1_R1_TU.fastq sample1_R2_TP.fastq sample1_R2_TU.fastq ILLUMINACLIP:/path/to/Trimmomatic-0.32/adapters/adapters.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
      Thanks for your help!

      Comment

      • westerman
        Rick Westerman
        • Jun 2008
        • 1104

        Originally posted by travelk View Post
        Obviously trimmomatic didn't put + on the next line and now tophat can't read the line properly. This has happened in multiple files. Does anyone know if a) this is normal for trimmomatic and I need to fix this manually or if b) I did something wrong to cause it?
        a) No. Not normal.

        b) Probably. But your command line looks ok and nothing obvious is popping up.

        Comment

        • tonybolger
          Senior Member
          • Feb 2010
          • 156

          Originally posted by travelk View Post
          Obviously trimmomatic didn't put + on the next line and now tophat can't read the line properly. This has happened in multiple files. Does anyone know if a) this is normal for trimmomatic and I need to fix this manually or if b) I did something wrong to cause it?
          It is certainly not normal - it's one of the strangest trimmomatic issue i have heard of. None the less, it should be possible to track down. Some questions:

          1) Does this happen consistently on the same lines of the same files if they are run more than once?
          1.1) If so, can you isolate and send me a short example where it happens?

          2) What OS are you using?

          Thanks,

          Tony.

          Comment

          • travelk
            Member
            • Jul 2013
            • 20

            Ok, I re-ran the files using the exact same script on the exact same files as suggested to check if it happened consistently on the same line... but now there is no problem with the new output files and tophat runs them just fine. So, I'm not sure what I did the first time around to have the files corrupt like that.

            Thank you nevertheless for taking the time to help me!

            Comment

            • drdna
              Member
              • May 2012
              • 76

              Trimmomatic is not working correctly in paired end mode:

              Read names in output files are not in the correct order. Correct phase was lost at read #27 and there are additional phase changes thereafter. Command line was as follows:

              java -jar /opt/Trimmomatic-0.32/trimmomatic-0.32.jar PE -threads -phred33 -trimlog Trim_Lesion6.txt 6_S1_L001_R1_001_clip2.fastq 6_S1_L001_R2_001_clip2.fastq 6_S1_L001_R1_001_paired.fastq 6_S1_L001_R1_001_unpaired.fastq 6_S1_L001_R2_001_paired.fastq 6_S1_L001_R2_001_unpaired.fastq MINLEN:40

              Comment

              • mastal
                Senior Member
                • Mar 2009
                • 666

                The command seems OK, except that you haven't specified the number of threads.

                Does trimmomatic give any error messages?

                Is there something wrong with the format of read 27 in one of your files
                that causes it to be read incorrectly?

                Do your 2 input files have the same number of reads, in the same order?

                What does the trimmomatic log file indicate is happening when the output files get out of phase?

                Comment

                • drdna
                  Member
                  • May 2012
                  • 76

                  Originally posted by mastal View Post

                  Do your 2 input files have the same number of reads, in the same order?
                  This was the problem. Interesting, there was, to my knowledge, no stipulation in the original publication, or in the online manual, that the program requires input files with perfectly paired reads. Maybe I'm stupid but I would have thought that a program that is designed to take raw reads, quality trim them and sort them in to paired and unpaired datasets would realize that raw data coming off a sequencing machine often has large numbers of unpaired reads to start off with. As it stands, it appears I have to run one script to cull unpaired mates and then run Trimmomatic. How inefficient is that?

                  Comment

                  • westerman
                    Rick Westerman
                    • Jun 2008
                    • 1104

                    Originally posted by drdna View Post
                    Maybe I'm stupid but I would have thought that a program that is designed to take raw reads, quality trim them and sort them in to paired and unpaired datasets would realize that raw data coming off a sequencing machine often has large numbers of unpaired reads to start off with. As it stands, it appears I have to run one script to cull unpaired mates and then run Trimmomatic. How inefficient is that?
                    Inefficient indeed. But I want to know what type of machine you have that has large numbers of unpaired reads? My miSeqs and hiSeqs always pair reads -- assuming that I tell them that the project is paired.

                    Comment

                    • drdna
                      Member
                      • May 2012
                      • 76

                      We have a MiSeq which gives us scads of high quality data but almost never gives us perfectly paired reads. I'll have to check with our tech to see if she sets any kind of paired data flag. Where would that be?

                      Comment

                      • westerman
                        Rick Westerman
                        • Jun 2008
                        • 1104

                        Settings would be in the sample sheet.

                        Are you getting the reads directly from the sequencer or via BaseSpace? The latter may be doing some sort of trimming for you. Because we have a hiSeq and pre-existing pipelines we do not use BaseSpace but rather just grab the raw reads. Thus I am not familiar with BaseSpace but I do know that it can do a lot of useful processing.

                        Comment

                        • GenoMax
                          Senior Member
                          • Feb 2008
                          • 7142

                          Only way I would see that happen is you get consistently bad quality reads on one end that are removed by MiSeq reporter/BaseSpace. Perhaps you should ask the tech to turn off on-instrument analysis (adapter trimming etc) and you can do that offline.

                          Comment

                          • drdna
                            Member
                            • May 2012
                            • 76

                            That's probably it - we use BaseSpace. My guess is that BaseSpace is filtering out pairs with poor quality. I'll have to look into that.

                            Comment

                            • drdna
                              Member
                              • May 2012
                              • 76

                              Thanks for the insights. BaseSpace does a good job of adaptor trimming, demultiplexing. It's probably more efficient to just run the reads through a script to pair them up properly before downstream processing.

                              Comment

                              • GenoMax
                                Senior Member
                                • Feb 2008
                                • 7142

                                repair.sh from BBTools will do that easily: http://seqanswers.com/forums/showpos...8&postcount=61

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                29 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                21 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                212 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                78 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...