Merging Assemblies with Minimus2

[SLB]

I am trying to use Minimus2 to merge abyss assemblies. I also want to use it to run my assemblies against some 454 reads to try and get better value from these longer reads. I managed to get it working with a smaller test set but having difficulty with larger concatenated files from the assemblies.

Is there a limit to the size of the input data that can be handled by miniums2?

I am considering chopping up my assemblies into smaller faster files. I can then merge each file with the 454 data in turn. I could then use a clustering tool (CD-HIT-EST) to merge all the files to remove redundancy. Has anyone any experience/recommendations doing something like this?

[SLB]

Here is one of the problems I am having, when I concatenate two files from an abyss assembly (.fa files) and convert to afg (with toAmos) for use in minimus2 I get the following error.

AFG ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:1, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:2, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:3, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:4, message ignored
and so on for all entries......

I am at a bit of a loss to what is going on.... I don't have quality scores.

here is what fasta file looks like:
>3520 2510 57729
ATATCTCATTTAGCTTCATTTGTATAACATCTGAAAACAAAAGTTAATCTCCACAGTCACAAGATAGCACTGAATTAGGT
TCATACACAGAGGAAGCTAGAAATTGCAGATTGGTTCCGCGCTCCAAGTTTTTTAAAAATGATGCTTAAATACTACCTGA
TACTCTAATCTTTGATGTAATACATGAAGGGAATAAGAAAAACACTTCATACCATGAGTTCATAGTGGTCCCTCACGCTG
CACTTGTCCCTCACGGATACGTCAAA

[milo0615]

toAmos error

Here is one of the problems I am having, when I concatenate two files from an abyss assembly (.fa files) and convert to afg (with toAmos) for use in minimus2 I get the following error.

AFG ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:1, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:2, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:3, message ignored
ERROR: Sequence and quality lengths disagree
could not parse 'RED' message with iid:4, message ignored
and so on for all entries......

I am at a bit of a loss to what is going on.... I don't have quality scores.

here is what fasta file looks like:
>3520 2510 57729
ATATCTCATTTAGCTTCATTTGTATAACATCTGAAAACAAAAGTTAATCTCCACAGTCACAAGATAGCACTGAATTAGGT
TCATACACAGAGGAAGCTAGAAATTGCAGATTGGTTCCGCGCTCCAAGTTTTTTAAAAATGATGCTTAAATACTACCTGA
TACTCTAATCTTTGATGTAATACATGAAGGGAATAAGAAAAACACTTCATACCATGAGTTCATAGTGGTCCCTCACGCTG
CACTTGTCCCTCACGGATACGTCAAA

Hi SLB,

Were you able to figure it out? I am having the same error trying to combine abyss output. I am following this protocol: http://ged.msu.edu/angus/metag-assem...et-multik.html

Please let me know if you were able to fix the problem.


Thank you,

-Milo